ID: 1088291944

View in Genome Browser
Species Human (GRCh38)
Location 11:108248526-108248548
Sequence CTTTCTGAAATGAAGATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 376}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088291944 Original CRISPR CTTTCTGAAATGAAGATACA GGG (reversed) Intronic
904922186 1:34016622-34016644 CATTCTGCTATAAAGATACATGG + Intronic
905212273 1:36382603-36382625 CTTTCTGAAAAGAAAATCTAAGG - Intronic
906474321 1:46157831-46157853 CTTTCAGAAGGGAAGATAGAAGG - Intronic
908184444 1:61639119-61639141 CTTTCAGAATTCAACATACATGG - Intergenic
908309691 1:62867227-62867249 TTTTCTAAAATCAAGAAACAAGG + Intergenic
908414056 1:63895410-63895432 CTTCATGAAACCAAGATACATGG - Intronic
909302880 1:74036458-74036480 CTTTCTAAAATGAAGACCCAGGG - Intronic
909431112 1:75588693-75588715 CTTCCTGAAATAAAGATATCTGG + Intronic
909588608 1:77319911-77319933 ATTTCTAAAATGAATAAACAGGG + Intronic
910453350 1:87370225-87370247 CTTTCTCAAAAGAAGATAGATGG - Intergenic
912094777 1:106125266-106125288 CTTCCTTAAATGATGATTCAAGG - Intergenic
913297001 1:117331678-117331700 CTTTCTGTAATAAAGCAACATGG - Intergenic
914191010 1:145410613-145410635 ACTTCAGAAAAGAAGATACATGG - Intergenic
915180702 1:154056958-154056980 CTTTCTCACCTGAAAATACATGG - Intronic
916757437 1:167786151-167786173 CTTTCTGAGATGAATATAGAGGG + Intronic
917076082 1:171206632-171206654 CTTTCTAAAATGCAGATTCCAGG - Intronic
917515647 1:175705695-175705717 CTTGCTGAAATCAAGACACATGG - Intronic
918336711 1:183522504-183522526 GTTTCAGAAATGAAGAAATATGG - Intronic
918800956 1:188970777-188970799 ATTACTGAAATGTAGATATAGGG + Intergenic
918925050 1:190772551-190772573 CTTTTTGAAACAAAGACACATGG + Intergenic
919239518 1:194894279-194894301 CTTTCTGATACGAAAATAAAGGG - Intergenic
919380732 1:196857170-196857192 TTTTCTGAGAAGAAAATACAGGG + Intronic
920084317 1:203404027-203404049 TTTTCTGAAATGATGACAGAAGG - Intergenic
920324700 1:205154012-205154034 CTATATGAAATTAAGTTACAAGG - Intronic
921298529 1:213727327-213727349 CCTTCTGAGATGAGGGTACAGGG + Intergenic
921761307 1:218918383-218918405 CTTTCAGAAATGAAGACCCAGGG + Intergenic
923607889 1:235461313-235461335 CTTGCTGAAATGCAGATTCCTGG + Intronic
923638537 1:235725871-235725893 CATTCTGAAATGAAGAGGTAGGG + Intronic
1063067552 10:2624439-2624461 CTTTGTGAAATGAACACACACGG - Intergenic
1063882854 10:10549105-10549127 ATTTATGAAATGGAGAGACAAGG + Intergenic
1065412659 10:25446550-25446572 AGTTCTGAAATGAATACACATGG - Intronic
1065422150 10:25556968-25556990 CTTTTTGAGATGAAGATTTAAGG + Intronic
1066324023 10:34336988-34337010 TTTTGTAAAATAAAGATACATGG + Intronic
1066405554 10:35114796-35114818 CTTCCAGAAATGAAAATGCAAGG + Intergenic
1066450021 10:35520513-35520535 CTATCTGAAATCCAGTTACAAGG + Intronic
1066540296 10:36439120-36439142 CTTTTTGAAATTAAGAGTCAGGG - Intergenic
1066979770 10:42402160-42402182 CTTGAAGAAATGAAGATACGTGG + Intergenic
1067915502 10:50393601-50393623 CTTTATGAAATGGAGTTACTAGG - Intronic
1068242287 10:54318256-54318278 CTTTCTGTCATGAAAATTCAAGG + Intronic
1068268399 10:54685463-54685485 CTTTCTGAGATGATGTTACAAGG + Intronic
1068883950 10:62079224-62079246 CTTTTTGAGATGAAGATAGCTGG + Intronic
1069088013 10:64164366-64164388 CTTCCTAAAATGAAGCTATAGGG + Intergenic
1069192738 10:65509802-65509824 CTTTCTGAAACTAAGTTAAATGG + Intergenic
1070258737 10:74832798-74832820 CTTTTTAAAATAGAGATACAAGG - Intronic
1071144587 10:82553148-82553170 CTTTCTAAAATGAAGGCAAATGG + Intronic
1071544396 10:86517456-86517478 CTTTCTGCACTTATGATACATGG - Intronic
1073763712 10:106658759-106658781 ATCTCTCACATGAAGATACAGGG + Intronic
1073808397 10:107125277-107125299 CTTTCTGAAATAAAGAAAATGGG - Intronic
1075652056 10:124133946-124133968 CTCTAGGAAATGAAGAAACATGG + Intergenic
1077429780 11:2510599-2510621 CTTTCTCAAAGGAACAAACAAGG + Intronic
1078063486 11:8062745-8062767 CTTTCTAAAATAAAGATTCCTGG - Intronic
1078282913 11:9920770-9920792 CATTCTGAAATAACGGTACAGGG - Intronic
1078543610 11:12230418-12230440 CCTTCTGGAGTGGAGATACAGGG + Intronic
1079515695 11:21265803-21265825 ATTTCTGAAATAAAAATACAAGG - Intronic
1079880056 11:25916086-25916108 GTTTCTTAAATGATGATACTAGG + Intergenic
1080240954 11:30126798-30126820 CTTTCTGAAAAGAAAAGAGAGGG + Intergenic
1080298168 11:30753724-30753746 CTTGCTGAAATGTAGAATCAGGG + Intergenic
1080989036 11:37507817-37507839 CCTTCAGAAATGAAGACCCAGGG - Intergenic
1081842249 11:46211125-46211147 TTTTGTGAAATGAAGGTAGATGG + Intergenic
1082927938 11:58570619-58570641 CTTTCTGGAATGCTGATCCAGGG + Exonic
1083087367 11:60164052-60164074 TCTTCCGAAATGAGGATACAAGG + Intergenic
1084669859 11:70599170-70599192 CTTGCTGAAATGTAGAAATATGG - Intronic
1084712030 11:70849565-70849587 CTTTGTCAAATGAAAATACAAGG + Intronic
1085332172 11:75662615-75662637 CTTTCTGAAATGCAGATTCCTGG - Intronic
1086535529 11:87840290-87840312 CTTCATGAAATTAAGAAACATGG + Intergenic
1087200156 11:95337169-95337191 CTTGCTGAAATAAAAATACCAGG + Intergenic
1087421321 11:97928381-97928403 GGTTCAGAAATGAATATACAGGG + Intergenic
1088193094 11:107247792-107247814 CTTTCTGAAAGGAAAAGAGAAGG + Intergenic
1088291944 11:108248526-108248548 CTTTCTGAAATGAAGATACAGGG - Intronic
1089344010 11:117778501-117778523 CTTTCATAAATGAAGAAACTGGG - Intronic
1089854619 11:121532220-121532242 TTTTCCCAAATGAAGAAACACGG - Intronic
1091050349 11:132362876-132362898 CCTTCAGAAATGAAGACCCATGG + Intergenic
1091400687 12:178939-178961 CTTTCTGCAATGAAGAGTGAGGG + Intergenic
1091644831 12:2265530-2265552 CTATCTGTAATGAAGGGACAGGG - Intronic
1091938778 12:4455283-4455305 ACTTCAGAAATGAAGACACAAGG - Intergenic
1092362895 12:7852759-7852781 CTTGCTGAAATCAAGGTGCATGG - Intronic
1092607157 12:10133095-10133117 CCTTCTGAAATGAAGACGCAGGG + Intergenic
1092888985 12:12951242-12951264 CATTCTGAAATGAAGACACCTGG + Intronic
1093282352 12:17210066-17210088 CTTTACCACATGAAGATACAGGG - Intergenic
1094148797 12:27258961-27258983 CTTTCTGAGAGGAAGAGAGATGG - Intronic
1094151873 12:27293824-27293846 CTTTTTGAAAGGAATATATAAGG + Intronic
1096385855 12:51195003-51195025 CTTGCTGGAATGAAGATTCCTGG - Intronic
1097161029 12:57046914-57046936 CTCTCTGAAGGGAAAATACATGG - Exonic
1101595055 12:106156806-106156828 CTTTCTGAAAAGAAGTGAGATGG - Intergenic
1103115602 12:118327910-118327932 CTTTCTGAAAATAAGAAAAAGGG - Intronic
1103279075 12:119739817-119739839 GTTTCTGAAATGTGGATACGTGG + Intronic
1104074360 12:125376576-125376598 CATTCTGAGATGAGGAAACAAGG - Intronic
1104236501 12:126943529-126943551 CTTTCAGAAAGGGTGATACATGG - Intergenic
1104584079 12:130033748-130033770 CTTGCTAAAATTCAGATACAGGG + Intergenic
1104584083 12:130033789-130033811 CTTGCTAAAATTTAGATACAGGG + Intergenic
1105956051 13:25283935-25283957 CTTTCAGAAATCCAGATTCAGGG + Intronic
1107856943 13:44625355-44625377 TTTTCAGAAATGAAAATTCATGG - Intergenic
1108477715 13:50837387-50837409 CTTTCTGAAATGAACATTTAGGG - Intronic
1109250092 13:60009333-60009355 CATTCTGAAGTCAAGAAACAAGG + Intronic
1109357653 13:61251848-61251870 CTGTCTGAAAGCAAGCTACATGG + Intergenic
1109378638 13:61527651-61527673 TTTTCAGCAATGAAAATACAAGG + Intergenic
1109662330 13:65479283-65479305 ATTTCTGAAAGGAAAATTCATGG - Intergenic
1110599630 13:77357761-77357783 CTTTCTGGAAACAAGATACAAGG - Intergenic
1110672324 13:78195239-78195261 CTTTTTGCAATGGTGATACAGGG + Intergenic
1111181198 13:84668113-84668135 CTTTCTCAAATAAAGCTAAAAGG - Intergenic
1111409887 13:87861046-87861068 CTTTCAGAAATAAAGATATAAGG + Intergenic
1111444482 13:88328910-88328932 CTTTCTCAAATGAAGAACCAGGG - Intergenic
1111467576 13:88636360-88636382 CTTTCCGGAATTAATATACAGGG + Intergenic
1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG + Intergenic
1111944886 13:94654587-94654609 CATTATGAAATGATGATGCATGG + Intergenic
1112178942 13:97057471-97057493 CAATCTGACATGAAGATACCAGG + Intergenic
1113072085 13:106431739-106431761 CCTTCTGAAATGAAGAATCGAGG + Intergenic
1113325434 13:109277050-109277072 CCTTCAGAAATGAAGACCCAAGG - Intergenic
1114263416 14:21056079-21056101 CATTCAGAAATGCAGATACTAGG + Intronic
1114445067 14:22782056-22782078 GATTCTGAAATGGAAATACATGG + Intronic
1114918139 14:27292391-27292413 CATTCTCAAATGCAGAAACATGG + Intergenic
1116113370 14:40615429-40615451 TTCTCTGATGTGAAGATACAAGG + Intergenic
1116122968 14:40743957-40743979 CATACAGTAATGAAGATACAAGG + Intergenic
1116316183 14:43395893-43395915 CTTTCTGACATGTTGACACAAGG - Intergenic
1116681835 14:47981641-47981663 ATTTCTGAAACAAAGACACAAGG + Intergenic
1116760063 14:49001926-49001948 CTTTCTAAAATGTAGCTACTAGG - Intergenic
1117456966 14:55907508-55907530 CTTGCTGAAATGAAGATTCCTGG - Intergenic
1117594087 14:57308547-57308569 CATTCTGAAAGGAAGGCACAAGG + Intergenic
1117964547 14:61193204-61193226 CTTTCCCAAAGGAAGATAAATGG + Intronic
1118532813 14:66726228-66726250 TTTTCTGAAATAAAGCTAAAAGG - Intronic
1119044104 14:71302254-71302276 CTCTCTCAAATGAAATTACAAGG - Intergenic
1119364800 14:74082835-74082857 GTTTCTGAAATAAAAGTACATGG + Intronic
1119684664 14:76622149-76622171 CTTTTTTAAAAGAAGAGACAGGG + Intergenic
1120036011 14:79699251-79699273 CTCACTGAAAAGAAGATAAAAGG + Intronic
1120217695 14:81697662-81697684 CTTACTAAAATAAAGATATATGG - Intergenic
1120358619 14:83465718-83465740 CTTTCTTCAACGAAGATCCAAGG + Intergenic
1121034066 14:90684646-90684668 CTTTTTGAAATTTATATACATGG - Intronic
1122877443 14:104675351-104675373 CTTTACTAAATAAAGATACAGGG - Intergenic
1123791107 15:23721379-23721401 GTTTCTCAAAAGAAGATAAATGG - Intergenic
1124807079 15:32895292-32895314 CTGTCTGACATGAAGAAAAAAGG + Intronic
1125171376 15:36769943-36769965 CCTTATGAAATGAACCTACAGGG + Intronic
1126420462 15:48466939-48466961 CTTTCTGAAGAGAAGAGAGAAGG + Intronic
1126470138 15:49001290-49001312 CTATTTGAAATGCAGAAACAAGG - Intronic
1127744153 15:61947835-61947857 CTTTGAGAAATGAACATAAAGGG + Intronic
1128136799 15:65269689-65269711 TTTTATAAAATGATGATACATGG + Intronic
1128479561 15:68025546-68025568 CTTTCAGAAACGAAAATCCAAGG + Intergenic
1131956208 15:97738958-97738980 ATTGCTGCAATGAACATACATGG + Intergenic
1132214254 15:100051028-100051050 ATTTCAGAAGTGAAGAAACATGG + Intronic
1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG + Intronic
1133423805 16:5669726-5669748 CTTTTTGAGATGAAAACACAAGG + Intergenic
1134876113 16:17700475-17700497 CTTTGAGAGATGAAGTTACATGG + Intergenic
1138318703 16:56092490-56092512 CTTCCTGAGATGAAGAGACAAGG + Intergenic
1138463664 16:57170541-57170563 CTTCCTCACATGAAGATAAATGG + Intronic
1140674134 16:77310408-77310430 ATTTCTGAAATGAGGAAACTGGG + Intronic
1141376379 16:83534516-83534538 CTATGTGAAATGAATGTACATGG + Intronic
1141507636 16:84489277-84489299 CTCTCTGACATGAAGCTGCAAGG - Exonic
1144746399 17:17618053-17618075 CTTTCTAAAATGAATAGAGATGG - Intergenic
1146424550 17:32724341-32724363 ATTTATGAAATGAAGATACGGGG + Intronic
1150315084 17:64162580-64162602 GTTTTTTAAATGAAGATATATGG + Intronic
1150935037 17:69626150-69626172 CTTTCTGGAAAGAAGTTACCTGG + Intergenic
1151077620 17:71292175-71292197 TTTTCTGAAATAAACATAAAAGG - Intergenic
1154945502 18:21157937-21157959 CTTCGGGATATGAAGATACAGGG + Intergenic
1155671258 18:28374264-28374286 CTTTGAGAAATAAAGATAAAGGG + Intergenic
1156234194 18:35185269-35185291 CTTTCTGCCATGAATATTCAGGG - Intergenic
1157418895 18:47528370-47528392 TTTTCTGAAATTAAGAAATATGG + Intergenic
1157871865 18:51237284-51237306 CTCTCTGATAAGAAGAAACATGG + Intergenic
1158426501 18:57344796-57344818 GATTTTGAAATGAAGATATAAGG + Intergenic
1160022271 18:75190083-75190105 ATTTCACAAATGAAGACACAAGG - Intergenic
1160367510 18:78340242-78340264 ATTTCTCAAAAGAAGACACATGG - Intergenic
1164008561 19:21175892-21175914 CATTCTATTATGAAGATACATGG - Intronic
925191509 2:1888173-1888195 CTTTCCTAAGTGTAGATACATGG + Intronic
925609069 2:5689076-5689098 ATCTCTGAAATGAAGTTATAAGG - Intergenic
925837227 2:7958104-7958126 ATTTCTGAAATGAAGATCTATGG + Intergenic
925871850 2:8278574-8278596 CTTTTAGAAACAAAGATACACGG + Intergenic
926380971 2:12288873-12288895 CTTTCTGAACTGAAGATTTCTGG - Intergenic
926869707 2:17400577-17400599 CGTTCTGAGAGGAAGAAACAGGG + Intergenic
926898273 2:17719692-17719714 CTTTCAGAAATGAAAATTTAAGG + Intronic
927297137 2:21467844-21467866 CTTGCTGAAATGCAGATTCTTGG - Intergenic
928634072 2:33225005-33225027 TTTTCTGAAATGTAAATAAAAGG + Intronic
929481424 2:42312020-42312042 CTTTTTGAAATGAAAATAATTGG + Intronic
930978398 2:57492489-57492511 CTTTGTGAGCTGAAGATAAATGG + Intergenic
931138145 2:59427538-59427560 ATTTCTTAAAGGAAGAAACAAGG - Intergenic
931556703 2:63513859-63513881 CTTTCAGAAATGAAGACCTAAGG - Intronic
933615437 2:84478415-84478437 CTTTCTGAAATGCACCTACAGGG + Intergenic
935042605 2:99447674-99447696 CTTTCACAAATGAGGAAACAAGG + Intronic
937600569 2:123726713-123726735 CATTTTGTAATGAAGAAACATGG - Intergenic
938138893 2:128780815-128780837 CTTTCTCAAATGATGCTGCAAGG - Intergenic
939551416 2:143620189-143620211 ATTTGTAAAATGAAGATAGAAGG - Intronic
939591519 2:144069401-144069423 CTTGCAGAGATGAAGAAACAGGG + Intronic
941266605 2:163370687-163370709 CATTCTTAACGGAAGATACAGGG + Intergenic
942214779 2:173707987-173708009 CTTTCATAAATGAAGATCAAGGG - Intergenic
942313592 2:174679168-174679190 ATTTCAAAATTGAAGATACAGGG + Intronic
942572215 2:177326096-177326118 CTTTCTGAGATGAAGCTACATGG + Intronic
942705846 2:178771098-178771120 CTTTATGAAATGAAAATTTATGG + Intronic
944160522 2:196654707-196654729 CCTACTGAAATGGAGATATATGG - Intronic
944453202 2:199865252-199865274 CATTCTGATATGAAAATACACGG - Intergenic
944736062 2:202567139-202567161 ATTTTTCAAATAAAGATACATGG + Exonic
945104226 2:206294153-206294175 TTTTCTGAAATGTATATAAATGG - Intronic
945593614 2:211765280-211765302 CTTTTTGGAAGGAAGATTCAGGG + Intronic
946510729 2:220353247-220353269 CTTTCTGAACAGAATATAGAGGG + Intergenic
946557675 2:220876712-220876734 TTTTCTGAAAATAAGAGACAAGG + Intergenic
946837545 2:223787408-223787430 CTCTCTTAAATGAAGACATATGG - Intronic
947081797 2:226406424-226406446 ATTTTTCAAAAGAAGATACAAGG + Intergenic
947557811 2:231112481-231112503 ATTCCTGAAATGATGATATAAGG - Intronic
948293260 2:236843000-236843022 ATTTCTCAAATAAAAATACAGGG - Intergenic
948580560 2:238985260-238985282 CTTTCTGGTATGAAGATAGCTGG - Intergenic
1169055245 20:2615450-2615472 CTTCCAGAAATGGAGATAAAGGG - Intronic
1170155560 20:13265989-13266011 CTGCCTGAAATGAGGAAACAAGG - Intronic
1170335448 20:15265712-15265734 CTTACTGAAAAGAAAATAAAAGG + Intronic
1170897873 20:20432432-20432454 CTTGCTGAAATGAATATATACGG - Intronic
1172504807 20:35453984-35454006 CTTTCTAAAATGCAGATTCCTGG + Intronic
1173591932 20:44231535-44231557 GTTTCTGAAAAGAACATGCAGGG - Intergenic
1175450011 20:59056306-59056328 TCTTTTGAAATGATGATACAGGG + Intergenic
1176916738 21:14634856-14634878 CATTCTGTTATAAAGATACATGG + Intronic
1176999835 21:15598631-15598653 CATTCTTAAATGAAGATCGAAGG - Intergenic
1177261667 21:18737328-18737350 TTTTCTGAGATGAAAATATATGG - Intergenic
1177310086 21:19379357-19379379 CTTTCTTAACTAATGATACAAGG - Intergenic
1177630725 21:23724224-23724246 CTTGCAGAAATGAAAATAAAGGG - Intergenic
1177705166 21:24694876-24694898 TTTTCTCAAATGAAAATAAAAGG + Intergenic
1177819825 21:26018748-26018770 CCTTCTGAAAGCAAGATACCTGG - Intronic
1181944071 22:26501892-26501914 CTTTCTCAAGTCAAGGTACAGGG - Exonic
1182205945 22:28627292-28627314 CTCTCTGAAGTTAAGATAAATGG - Intronic
1182935182 22:34215460-34215482 CTTTCTGAAAAGCAGATTTATGG + Intergenic
1183891322 22:40931249-40931271 CTCCCTGAATTGAAGATACATGG + Exonic
1184427311 22:44418870-44418892 CCTTCTCAAATAAAGAAACAAGG - Intergenic
949391252 3:3564970-3564992 CTTTCTAGACTGAAGATTCATGG - Intergenic
949809738 3:7993296-7993318 CTTTGTAAAATGAAGCTCCAAGG - Intergenic
951211290 3:19977934-19977956 CTGTCTGCAATGAAGACAAAGGG - Intronic
952369922 3:32711990-32712012 CTTTCAAAAAAGAAGATAAAAGG - Intronic
953796796 3:45992181-45992203 CTTTCAGGAATGGAGAGACAAGG - Intronic
955008804 3:54994492-54994514 CTTTCTGGAAGGCAGAGACATGG + Intronic
955076302 3:55616974-55616996 CTCCCTGGGATGAAGATACAGGG - Intronic
955098662 3:55825147-55825169 CAGTTTGAAATGAAGACACAAGG - Intronic
955845312 3:63156430-63156452 CTGTGTGAAATGAAGAAACTGGG - Intergenic
956181818 3:66524472-66524494 CTCTGAGAAATGAATATACAAGG + Intergenic
956760796 3:72442636-72442658 TTTTTTTAAATGAAGAGACAAGG - Intronic
956803005 3:72779932-72779954 CTTTCTGATAAAAAGGTACAAGG + Intronic
957333613 3:78797908-78797930 CTTTATGATATGAGGAAACAGGG + Intronic
957437832 3:80201586-80201608 AGTTCTGCAATGAACATACATGG - Intergenic
958591726 3:96167757-96167779 TATTCTCAAATGAAGATAAATGG + Intergenic
959190964 3:103110862-103110884 GTTTTTCAAATGAAGAAACAAGG + Intergenic
959235364 3:103714947-103714969 ATTTCTCAAAAGAAGATAAATGG + Intergenic
959629172 3:108489242-108489264 CTTTATGAAGTGAATACACAGGG + Intronic
960724243 3:120654174-120654196 CTTTCTGAAACTAAGATTCTAGG - Intronic
963302206 3:143611129-143611151 CTTTTAGAAATAAAAATACAAGG + Intronic
964199926 3:154107820-154107842 CTTTATAAAATGCAGATTCATGG + Intergenic
964428179 3:156575100-156575122 CATTTCTAAATGAAGATACATGG - Intergenic
965193937 3:165569773-165569795 CTTTCTGAACTGAAAATTAAAGG + Intergenic
965536478 3:169828780-169828802 CTTTCAAAACTGAAGATACTTGG + Exonic
965542603 3:169885001-169885023 CTTTTTGTGATGAAAATACATGG + Intergenic
966243926 3:177784961-177784983 CTTTCTGAAAACAAGAAATATGG - Intergenic
966478602 3:180379280-180379302 ATTTCTCAAAGGAAGATAAATGG - Intergenic
967161292 3:186740759-186740781 CTTTATGAACTGAATATATAGGG - Intronic
967282348 3:187834384-187834406 CTTTCTGAAGTGAAGATGATGGG + Intergenic
967332119 3:188300887-188300909 TTTTCTTAAATGAAGATTGAAGG + Intronic
967532794 3:190568288-190568310 GTTTAGGAAATGAAGATCCAGGG + Intronic
968617826 4:1587963-1587985 CATTGAAAAATGAAGATACAAGG - Intergenic
969442106 4:7223567-7223589 CTCTCTGAAATGAAGTCACAAGG + Intronic
971412018 4:26384146-26384168 ATTTCTAAAATCAAGAAACAAGG - Intronic
971828610 4:31660909-31660931 CCTTCTGAATTCAAGAGACATGG + Intergenic
972103926 4:35459122-35459144 CTGTGTAAAATGAAGATAAAAGG - Intergenic
972515644 4:39808371-39808393 CATTTTGCAATGAAGAAACAGGG + Intergenic
973850046 4:54952725-54952747 TTTTATGAAATGAAGATTTATGG - Intergenic
974271197 4:59653308-59653330 TTTTCTGAAAGGCAGATAGAAGG - Intergenic
974447959 4:62011262-62011284 CTTTCGGAAATGGAGACTCAAGG + Intronic
974546083 4:63308553-63308575 CCTTCAGAAATGAAGATCCAAGG - Intergenic
974837171 4:67265084-67265106 TTTACTGAAATGAAGATATAAGG + Intergenic
974953172 4:68605769-68605791 GTTAATGAAATGAAGATAAAAGG + Intronic
976067402 4:81204609-81204631 CTTTCTCAAAGGAAAATTCAGGG + Exonic
976548637 4:86367606-86367628 CTTTCTCAAGTGAGGGTACAGGG - Intronic
976617823 4:87096112-87096134 CTTTGTGAAATGAAGGGAAAAGG + Intronic
977714375 4:100165606-100165628 CTTACTGAAAAGAACACACAAGG + Intergenic
977776319 4:100923943-100923965 ATTTCTGAAAAGAAGATAAATGG + Intergenic
977789309 4:101079622-101079644 CTTTCTGAGATTAAGAGAAATGG - Intronic
977853893 4:101864685-101864707 CCTTCAGAAATGAAGACCCAAGG + Intronic
978499139 4:109389875-109389897 CTTTCTGAAATAAAGATACCAGG + Intergenic
979565625 4:122151719-122151741 ATTTGTGAAATGGAGATAAACGG + Intergenic
979885070 4:126016991-126017013 CTTTCTGAAAAGAAAACATAAGG + Intergenic
981154222 4:141414827-141414849 ATTTATGAAATGAGGATATATGG - Intergenic
981483201 4:145258842-145258864 TGTTTTGAAATGAAAATACATGG + Intergenic
981677237 4:147356455-147356477 CTTTTTGAAATGAACATGAAAGG - Intergenic
981907731 4:149941931-149941953 CTTTCTACAATGCAGATATATGG + Intergenic
982322000 4:154086671-154086693 CTTTTTAAAATGTAGAAACAGGG - Intergenic
982641517 4:157967692-157967714 GATTCTGAAATAAAGATATATGG - Intergenic
982731570 4:158961273-158961295 CATTCTGAACTGAAGCTTCAGGG - Intronic
982796560 4:159653254-159653276 CCTTCTGAATTGAAGTGACAGGG - Intergenic
983091385 4:163506731-163506753 CTATCTTCAAAGAAGATACAGGG - Intronic
983234590 4:165164803-165164825 CTTTTTTAAATTAAGATACGGGG - Intronic
984799216 4:183697656-183697678 CTGTCACAAATGAAGATAAAAGG - Intronic
986201854 5:5586372-5586394 CTCTCTGAAGTGCAGATCCATGG - Intergenic
986423947 5:7612335-7612357 TTTTATGCAATGCAGATACAGGG + Intronic
986648455 5:9941040-9941062 CTTTCTCAAAGGAAGACAAAAGG + Intergenic
986749112 5:10770131-10770153 CCTTCTGAAATGAAAAGAGAAGG - Intergenic
986887422 5:12256703-12256725 ATTCCTGAACTGAGGATACAAGG - Intergenic
988582949 5:32484353-32484375 TTTTCTGAAGTGGATATACAGGG - Intergenic
988634781 5:32970921-32970943 CTTTAGGAAATGAATATACTAGG + Intergenic
989483364 5:41959179-41959201 ATTTCTCAAAAGAAGATATACGG - Intergenic
990549286 5:56857103-56857125 ATTTCTGAAATTAAGATCCTTGG - Intronic
991075817 5:62536315-62536337 TTTTCTGAAAGGAAAATATATGG + Intronic
992127297 5:73654828-73654850 TTTTCTGAAATGAAAAGTCAAGG + Intronic
993927819 5:93893052-93893074 CTTTCTTCCATGAAAATACATGG + Intronic
994289522 5:98012118-98012140 CTTTATAAAATTAATATACATGG - Intergenic
996126898 5:119736187-119736209 CTTTCTTAAATGAAAATAGATGG + Intergenic
996331844 5:122338279-122338301 CCTTTTGAAATGCAGATAGAGGG + Intronic
997034080 5:130166509-130166531 TTTCCGGAAATGAAGATACAAGG - Intronic
997039215 5:130232380-130232402 TTTTCTGAAATGCAGTTACAAGG + Intergenic
997190407 5:131929034-131929056 CTTTCAAAAATGGAGAGACAAGG - Intronic
997403492 5:133621964-133621986 ATGTATAAAATGAAGATACATGG + Intergenic
997448353 5:133960347-133960369 CTTTATGAAATGAAAACAGAGGG - Intronic
997477660 5:134154950-134154972 CCTTGTGAAATGCAGGTACAGGG - Exonic
998624411 5:143829258-143829280 ATTTCTAAAATTAACATACAAGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
998978534 5:147674844-147674866 CTTCCTAAAATGCAAATACAAGG - Intronic
999605284 5:153307117-153307139 CCTTCAGAAATGAAGACCCAAGG - Intergenic
999945045 5:156586465-156586487 CTCTTTGAAATGAAGATACTAGG + Intronic
1000748767 5:165068777-165068799 AGTTCTGCAATGAATATACACGG + Intergenic
1000830526 5:166095965-166095987 ATTTTTGAAATGAAAATAAAAGG - Intergenic
1001272576 5:170326244-170326266 CTTTTTGAAAGGAAGTTACTAGG - Intergenic
1001762592 5:174220659-174220681 CTTTCTGAAGAGAAGATAATTGG + Intronic
1002387874 5:178882798-178882820 CTTTCTGATATGAAGTTCCAGGG - Exonic
1002838980 6:889604-889626 CTATTTGAAATGAACATAAAAGG + Intergenic
1002972068 6:2033766-2033788 CTTTCTAAAATGCAGATTCTTGG + Intronic
1002980427 6:2130612-2130634 CTTTCTGAAATGCTGATACTTGG - Intronic
1003032504 6:2614489-2614511 CTTTCTATCATGAAGACACATGG - Intergenic
1004941672 6:20564795-20564817 CTTTCTAAAATGAATAAACCTGG - Intronic
1005702934 6:28421420-28421442 CTTTATTAAATGAAGAAAGAAGG + Intergenic
1006081487 6:31570062-31570084 CCTTCAGAAATGAAGACCCAAGG - Intergenic
1006699369 6:35959316-35959338 AATTCAGAAATTAAGATACAAGG - Intronic
1006971226 6:38047769-38047791 GTTCCTGGAATGAAGATACGTGG + Intronic
1007209574 6:40181467-40181489 CCTTCAGAAATGAAGATCCAAGG - Intergenic
1007641648 6:43345314-43345336 TTTTCTGAAATGAACAGAAAGGG + Intronic
1009767434 6:68098959-68098981 CTTTGTGAAATGTCTATACAAGG - Intergenic
1009807982 6:68627110-68627132 CTTTGTTAAAGGAATATACATGG + Intergenic
1010331913 6:74632921-74632943 CTTCCTCAAAGGAATATACATGG + Intergenic
1011997089 6:93604931-93604953 TTTGCTGAGATGAAGATAAAAGG - Intergenic
1012078129 6:94720869-94720891 ATTTCTTAAATGCAGATTCATGG - Intergenic
1012785987 6:103626416-103626438 CTTTCAGTGGTGAAGATACAGGG + Intergenic
1012837000 6:104281588-104281610 ATCACTGAAATGAAGATACAAGG + Intergenic
1013479250 6:110538953-110538975 CTTTCTGATAGGAAAATCCAGGG - Intergenic
1013529794 6:111008665-111008687 TTTTCTGAGTTGAATATACAAGG + Intronic
1014292492 6:119575377-119575399 CTTTCTGAATTGCCTATACAGGG - Intergenic
1014390712 6:120859048-120859070 CCTTCAGAAATGAAGAGATAAGG + Intergenic
1014809313 6:125867875-125867897 CTTTCTGGAAGGAAGATTCCAGG - Intronic
1016634074 6:146267354-146267376 CTTTCTATTATAAAGATACATGG - Intronic
1016695911 6:146995651-146995673 CTTTCCAAAAAGAAAATACAAGG - Intergenic
1017017202 6:150111079-150111101 CTTTTTCAAATGAAGACACTGGG + Intergenic
1017299686 6:152842240-152842262 ATTTCTGAACTGAAGAATCAAGG - Intergenic
1018225356 6:161622787-161622809 CCTTCTGAAATGAATTTTCAAGG + Intronic
1018511859 6:164532939-164532961 CTTTCTGAAAAGAAAACACTAGG - Intergenic
1019105617 6:169664742-169664764 CTTTGTGAAATGAACTTAAAAGG + Intronic
1020231770 7:6324585-6324607 CTTTCTGAAAAACAGAAACAGGG + Intergenic
1020232606 7:6331258-6331280 AGTTCTAAAATGAAGACACATGG + Intronic
1020266590 7:6564613-6564635 CTTTCTGGACTGAGGAGACAGGG + Intergenic
1020821129 7:12969175-12969197 CTTGCAGAAAGGATGATACAAGG - Intergenic
1021103990 7:16616402-16616424 CTTTGTGAAATGTAGAGAAAAGG + Intronic
1021571562 7:22070805-22070827 TTTTCTTTAATGAAGATTCAGGG - Intergenic
1022193503 7:28041044-28041066 CTTTCAGAAATGCATATAAATGG + Intronic
1024030097 7:45453750-45453772 ATTTTGGAAATAAAGATACATGG + Intergenic
1024705278 7:51951033-51951055 CTTTCTGCAATGGAGATCCCTGG + Intergenic
1027482888 7:78720975-78720997 AAATCTGAAATGGAGATACAGGG + Intronic
1028312003 7:89350385-89350407 AGTTCTGAAATGATGATTCAGGG - Intergenic
1028366795 7:90041492-90041514 CTTTCTTATATAAATATACATGG - Intergenic
1029166800 7:98597391-98597413 ATTTCTGAAATGCAGCTTCAAGG - Intergenic
1029315577 7:99710124-99710146 CTTTGTGCTATGAAGAGACATGG - Intronic
1029321300 7:99762915-99762937 CTTTGTGGTATGAAGAGACACGG - Intronic
1030648590 7:112092146-112092168 GTTTGGCAAATGAAGATACAAGG + Intronic
1030745419 7:113160145-113160167 CATTCTGGAAGGAAGAAACAAGG - Intergenic
1030995927 7:116358298-116358320 TTTTTTGAAATGAACATAAAAGG - Intronic
1031111333 7:117613077-117613099 CTCTATGAAAGGAATATACATGG + Intronic
1034069999 7:148175424-148175446 CTTTCTGGAATGGAGAAGCATGG + Intronic
1036415020 8:8538897-8538919 CTCTCTGAAATAAAGATTGAAGG - Intergenic
1036912559 8:12769343-12769365 TTTTCTGAAATGCAGATTCATGG + Intergenic
1037271739 8:17137544-17137566 CAGTGTGAAATGAAAATACAGGG - Intergenic
1038555151 8:28506481-28506503 CTAACTGAAATGAAAAAACAGGG - Intronic
1038728825 8:30108082-30108104 GTTTTTGAAATGAAAATATATGG + Intronic
1040904542 8:52452770-52452792 CTTTGTGAAATGTAGAAACCTGG - Intronic
1041104759 8:54430496-54430518 CTTACTAAATTGAAAATACATGG - Intergenic
1041145110 8:54867388-54867410 CTTTCAAAAATAAAAATACAAGG - Intergenic
1041989632 8:63970949-63970971 CTTTCTGAAAGGTATAAACAGGG - Intergenic
1042000605 8:64119338-64119360 CTTTTTAAAAAGAAGATATAAGG + Intergenic
1044001934 8:86893555-86893577 GTTTCTGAAATCAAGATCTAGGG - Intronic
1045550379 8:103166084-103166106 TTTTCTGAAATGACCACACACGG + Intronic
1045937538 8:107698149-107698171 CTTTTACAAATGAAGAAACAAGG + Intergenic
1046739756 8:117815577-117815599 CTTTCTTAAATGAACTAACAAGG - Intronic
1046747923 8:117895974-117895996 GTTTCTGAAATACAGATAAACGG + Intronic
1047300971 8:123613197-123613219 CCTTCAGAAATGAAGACCCAGGG + Intergenic
1048235592 8:132686775-132686797 TTTCCTGAAATGAAGATTGAAGG + Intronic
1048735119 8:137490666-137490688 CTTTCTGGAGTGTAGATAAAAGG - Intergenic
1048864989 8:138753809-138753831 CTTCCTGAGATGAAAATATATGG - Intronic
1048877573 8:138849093-138849115 CTGTCTGAAATGGAGATGCGTGG - Intronic
1050176423 9:2873756-2873778 CTTTCTGGAATGAAGATCGGGGG - Intergenic
1051875820 9:21792165-21792187 ATTTCTCAAAAGAAGATAAATGG + Intergenic
1052474649 9:28943333-28943355 CTCTCTAAAATAAAGATCCAAGG + Intergenic
1052564539 9:30131286-30131308 CGTGCTGAAATAGAGATACAAGG + Intergenic
1052976933 9:34418222-34418244 GTTTTTGAAATGAAGAGACAGGG + Intronic
1053382648 9:37661368-37661390 CTTACAGAAAAGAAGATACAGGG + Intronic
1054925953 9:70588897-70588919 CTTTCTCAAATGGATATAGAAGG - Intronic
1055074031 9:72195231-72195253 AATTCTCAATTGAAGATACAAGG - Intronic
1055539143 9:77283450-77283472 ATTTCTGAAATTAAGATTGAAGG + Exonic
1057040010 9:91841137-91841159 CTTTGTAAAATGAGGATAAAAGG - Intronic
1057861029 9:98641020-98641042 CTTACTGAAATGCACATACCTGG + Intronic
1058567305 9:106300071-106300093 GTTTCTAAAATAAAGATACATGG - Intergenic
1058620289 9:106875785-106875807 CTTTCTGACATGCAGTTATATGG + Intronic
1060048492 9:120359692-120359714 TGTTCTGAAATGAAAATCCAGGG + Intergenic
1060139233 9:121192104-121192126 CTTTCTAAAAAGTAGAAACATGG + Intronic
1060319842 9:122548150-122548172 CTTAAGGAAATGAAGATCCAAGG + Intergenic
1061344016 9:130007443-130007465 TGTTCTGAAATGAAGAGAAAGGG + Intronic
1187573144 X:20525976-20525998 TTCTCTGAAATGAAGGTAAAAGG + Intergenic
1187642937 X:21314567-21314589 GTTGCTGACTTGAAGATACAGGG + Intergenic
1188084616 X:25888172-25888194 CTTTCTGAAGTTAATATAAATGG - Intergenic
1188949838 X:36357369-36357391 CTTCATTAAATGAAAATACAAGG + Intronic
1190367112 X:49705981-49706003 ATTTCTGTATTGAAGATAGAAGG + Intergenic
1191635707 X:63373828-63373850 ATTTCTCAAAAGAAGACACACGG + Intergenic
1191888000 X:65909054-65909076 CATGCTGAAATGAAGACACTAGG - Intergenic
1192926641 X:75760564-75760586 CTTTCTGAAATGAAGCCATTTGG + Intergenic
1193292925 X:79797899-79797921 ATTTCTGAAATCTAGATATAGGG + Intergenic
1193943203 X:87702429-87702451 CTTTCTGTGAGGAAGATACCTGG - Intergenic
1194221695 X:91200774-91200796 ATTTCTGAAATAAATATACATGG - Intergenic
1195397714 X:104429227-104429249 CTTCATGAAATGAAGGCACATGG + Intergenic
1196627967 X:117899639-117899661 CTTTCTCAAATGTAGATCCCTGG + Intronic
1196702124 X:118681470-118681492 ATTTCTGATATGTACATACAGGG - Intronic
1196915744 X:120533302-120533324 CTTACTGAAATCAATCTACAGGG - Intronic
1197530458 X:127617398-127617420 CTGTCATAAATGCAGATACATGG + Intergenic
1198424613 X:136504176-136504198 CTTTCTGAAATAAAAATAATGGG - Intronic
1198611129 X:138401823-138401845 CTTTCTGAAGAGAAGATAATTGG + Intergenic
1199520299 X:148727476-148727498 CTTTTGGAAATAAAGATAAATGG + Intronic
1200558212 Y:4664530-4664552 ATTTCTGAAATAAATATACATGG - Intergenic
1201788334 Y:17809219-17809241 CTTCCTGTTCTGAAGATACATGG - Intergenic
1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG + Intergenic
1201850228 Y:18472281-18472303 CTTCCTGGTCTGAAGATACATGG + Intergenic
1201883090 Y:18848096-18848118 CTTCCTGGTCTGAAGATACATGG - Intergenic