ID: 1088294667

View in Genome Browser
Species Human (GRCh38)
Location 11:108278811-108278833
Sequence CCCATTAGGCATAACCTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088294654_1088294667 29 Left 1088294654 11:108278759-108278781 CCTCAGGCCTTAATCTATTCGTG 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1088294667 11:108278811-108278833 CCCATTAGGCATAACCTAATGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1088294659_1088294667 -4 Left 1088294659 11:108278792-108278814 CCCCATGACTCCGACACCTCCCA 0: 1
1: 5
2: 139
3: 1167
4: 4809
Right 1088294667 11:108278811-108278833 CCCATTAGGCATAACCTAATGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1088294653_1088294667 30 Left 1088294653 11:108278758-108278780 CCCTCAGGCCTTAATCTATTCGT 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1088294667 11:108278811-108278833 CCCATTAGGCATAACCTAATGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1088294658_1088294667 -3 Left 1088294658 11:108278791-108278813 CCCCCATGACTCCGACACCTCCC 0: 1
1: 5
2: 115
3: 1042
4: 5156
Right 1088294667 11:108278811-108278833 CCCATTAGGCATAACCTAATGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1088294657_1088294667 22 Left 1088294657 11:108278766-108278788 CCTTAATCTATTCGTGAGGGATC 0: 1
1: 2
2: 4
3: 6
4: 97
Right 1088294667 11:108278811-108278833 CCCATTAGGCATAACCTAATGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1088294661_1088294667 -6 Left 1088294661 11:108278794-108278816 CCATGACTCCGACACCTCCCATT 0: 1
1: 1
2: 30
3: 302
4: 1155
Right 1088294667 11:108278811-108278833 CCCATTAGGCATAACCTAATGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1088294660_1088294667 -5 Left 1088294660 11:108278793-108278815 CCCATGACTCCGACACCTCCCAT 0: 1
1: 1
2: 41
3: 384
4: 1725
Right 1088294667 11:108278811-108278833 CCCATTAGGCATAACCTAATGGG 0: 1
1: 0
2: 0
3: 5
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088294667 Original CRISPR CCCATTAGGCATAACCTAAT GGG Intronic
907850293 1:58249394-58249416 CCAATTAGGCATAACCTTGTAGG - Intronic
918282610 1:183022181-183022203 CCCATTACGCCTATCTTAATGGG + Intergenic
919504515 1:198382312-198382334 CCCATTAGCCTAAACCTAAATGG + Intergenic
1070664765 10:78335298-78335320 CTCACTAGGCAAAACCTCATGGG + Intergenic
1075343134 10:121663019-121663041 CCACTGAGGCCTAACCTAATGGG - Intergenic
1080536291 11:33225156-33225178 CCCATTAGGCATATTTTAATTGG - Intergenic
1081250009 11:40817948-40817970 CCCATTAGGCATAATTAACTTGG - Intronic
1088294667 11:108278811-108278833 CCCATTAGGCATAACCTAATGGG + Intronic
1099479285 12:83145910-83145932 TCCTTTAGGCACAACCTATTTGG + Intergenic
1099567895 12:84276359-84276381 CCCATTTGGCAGAGCCTAACAGG + Intergenic
1101694479 12:107111992-107112014 CCCCTTAGGCAAAACTAAATTGG - Intergenic
1108241790 13:48472183-48472205 CCCATTAGGTACAACCATATGGG - Intronic
1110382721 13:74873200-74873222 CCCACTAGGGCTAACCTCATTGG + Intergenic
1114581399 14:23763371-23763393 CTCATTTGGCTTAACCTAAGAGG + Intergenic
1126299515 15:47180317-47180339 AACATTTGGTATAACCTAATGGG + Intergenic
1147365103 17:39953889-39953911 ACCATTGGGCCTAACCTAGTAGG - Intergenic
1154423944 18:14257943-14257965 TCCAAGAGGCATAACCTCATGGG + Intergenic
1160399047 18:78595849-78595871 CCCATGAGGCATCAGTTAATGGG - Intergenic
1163579834 19:18131831-18131853 GGCATTGGGCATAACCTAAGGGG + Intronic
1167635943 19:50655806-50655828 CCTGTTAGGCAGAGCCTAATAGG + Intronic
926821168 2:16853299-16853321 CACATGAGGCATAACCAAACAGG - Intergenic
938595758 2:132785538-132785560 CCCATCAGTGATAACCAAATGGG - Exonic
943104138 2:183522276-183522298 CCCCTTAGTAATAACCTAATAGG - Intergenic
947170230 2:227303655-227303677 CTCATTAAGCATGACCTACTGGG + Intronic
948553077 2:238787745-238787767 TCCAGCAGGCATAACCTAAGAGG + Intergenic
1179073823 21:38099085-38099107 CACATGAGGCATAAACTCATAGG - Intronic
1179110276 21:38440154-38440176 CCCATTATGCATAAGCTAAGAGG + Intronic
1179355947 21:40659730-40659752 CCCATTAGGCTGTACCTGATGGG + Intronic
1179355946 21:40659730-40659752 CCCATCAGGTACAGCCTAATGGG - Intronic
949658675 3:6251963-6251985 CCCAATAGTCATGGCCTAATAGG - Intergenic
951455638 3:22889190-22889212 CCCATTAGGAATCACAAAATGGG - Intergenic
955098099 3:55820022-55820044 CCCTTTAGGAACAACCTCATGGG - Intronic
955148877 3:56347370-56347392 CCCTATAGGCAGAACCTAACAGG - Intronic
956312069 3:67892401-67892423 CCTATCAGACATTACCTAATCGG + Intergenic
957593811 3:82234223-82234245 CCCCTTAGTCATAACCAGATGGG - Intergenic
965812744 3:172608754-172608776 CCAAATTGGCATGACCTAATAGG - Intergenic
967414635 3:189202517-189202539 CCTTTTAGGCAAAACGTAATAGG + Intronic
971489887 4:27200708-27200730 CCCATTAGGCATATCCCCCTGGG - Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
977299538 4:95252493-95252515 CCCATTAGCCATTGACTAATGGG + Intronic
982739786 4:159045496-159045518 CCCATAGGGCATAGCCTAAAAGG + Intergenic
989078236 5:37587600-37587622 CCAAAAATGCATAACCTAATGGG - Intronic
1007328025 6:41077899-41077921 CCCATTACTCATAACCAAAATGG - Intronic
1013872404 6:114781253-114781275 TCCTTTAGGCAGAACATAATTGG + Intergenic
1015392070 6:132693945-132693967 TTCATTAGGCATTAACTAATTGG + Intronic
1033538565 7:142334774-142334796 CCCATAAGACATGCCCTAATAGG - Intergenic
1036741835 8:11370001-11370023 CCCCTTTGGCATCCCCTAATAGG + Intergenic
1040699839 8:50048836-50048858 CCTATTAGGCAAAACTTACTTGG - Intronic
1045440407 8:102203082-102203104 CCCATTAGCCAAAACCAACTAGG - Intergenic
1056516307 9:87353754-87353776 CCCTTAAGGCTTAACCAAATTGG - Intergenic
1058473876 9:105310206-105310228 CCCATTAAGCATAATCTTAGAGG - Intronic
1059046709 9:110876968-110876990 CCCATTACACCTCACCTAATGGG + Intronic
1186520664 X:10203918-10203940 CCCATTATGTATTACATAATGGG + Intronic
1187483344 X:19678531-19678553 CACCTTAGTCATAACCTAAGTGG - Intronic
1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG + Intergenic
1192868653 X:75163807-75163829 CTCATCAGGCCTCACCTAATAGG - Intergenic