ID: 1088294668

View in Genome Browser
Species Human (GRCh38)
Location 11:108278812-108278834
Sequence CCCCATTAGGTTATGCCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088294668_1088294674 6 Left 1088294668 11:108278812-108278834 CCATTAGGCATAACCTAATGGGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1088294674 11:108278841-108278863 TTTCAACATGACATTTGGAGGGG 0: 9
1: 965
2: 1864
3: 2881
4: 5759
1088294668_1088294673 5 Left 1088294668 11:108278812-108278834 CCATTAGGCATAACCTAATGGGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1088294673 11:108278840-108278862 ATTTCAACATGACATTTGGAGGG 0: 11
1: 1105
2: 2313
3: 5214
4: 15475
1088294668_1088294671 1 Left 1088294668 11:108278812-108278834 CCATTAGGCATAACCTAATGGGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1088294671 11:108278836-108278858 TCAGATTTCAACATGACATTTGG 0: 1
1: 50
2: 1220
3: 2723
4: 5404
1088294668_1088294672 4 Left 1088294668 11:108278812-108278834 CCATTAGGCATAACCTAATGGGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1088294672 11:108278839-108278861 GATTTCAACATGACATTTGGAGG 0: 1
1: 50
2: 1337
3: 2522
4: 3601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088294668 Original CRISPR CCCCATTAGGTTATGCCTAA TGG (reversed) Intronic
902037321 1:13467343-13467365 CTCCATGAGGTCATGACTAATGG - Intergenic
913408757 1:118526762-118526784 CTCAATTAGGTTATTCCTAATGG + Intergenic
919388920 1:196956393-196956415 CACTATTAGTTTATGCCTTATGG + Intronic
921182408 1:212641969-212641991 CCCCTGTAAATTATGCCTAAAGG - Intergenic
924936639 1:248777536-248777558 CCCCACTAGGGCATGCCTAGTGG + Intergenic
1063908928 10:10810479-10810501 CCCCATTGGGGGATGCTTAAGGG - Intergenic
1064962724 10:20983722-20983744 TCTCATTAGTTTGTGCCTAATGG - Intronic
1069126818 10:64645293-64645315 CCCCCATAAGTTATGCCTATGGG + Intergenic
1071927694 10:90429802-90429824 CCCATTTAGTCTATGCCTAAAGG + Intergenic
1087202940 11:95364405-95364427 CCCCAGTAGGTTCTCCCTTATGG - Intergenic
1088294668 11:108278812-108278834 CCCCATTAGGTTATGCCTAATGG - Intronic
1089717751 11:120379783-120379805 CCCCATTTGGTTTATCCTAATGG + Intronic
1099246684 12:80201096-80201118 CCTCCATAGGTTATGCCTAAGGG - Intergenic
1099479286 12:83145911-83145933 ACCAAATAGGTTGTGCCTAAAGG - Intergenic
1105264445 13:18803617-18803639 CCCCATGAGGTTCTGCCTCTTGG + Intergenic
1106061898 13:26301371-26301393 CCACATTAAATTTTGCCTAATGG - Intronic
1118255911 14:64205675-64205697 CCCCATTACCTTATACTTAAAGG - Intronic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1125410143 15:39397640-39397662 CTACATTAGGTTAGGCCCAAGGG + Intergenic
1126357439 15:47811456-47811478 ACCCATTAGGTAATGCCTCCAGG - Intergenic
1136098755 16:27977899-27977921 CCCCATAAGGTGATGCCACAAGG - Intronic
1139738826 16:69017250-69017272 CCCCATTAGGTTTTGCCATGAGG + Intronic
1143867284 17:9933282-9933304 GAACATTAGGTTATGCCAAAGGG - Intronic
1146470592 17:33121323-33121345 CCCCACTGGGTGATTCCTAAAGG - Intronic
1154423945 18:14257944-14257966 CCCCATGAGGTTATGCCTCTTGG - Intergenic
1156975757 18:43219993-43220015 CCCCATTGGGTAATGCCTGGGGG - Intergenic
1165783034 19:38444738-38444760 CTCCATTTGGGTATGCCTGAAGG - Intronic
938595757 2:132785537-132785559 CCCCATTTGGTTATCACTGATGG + Exonic
943104137 2:183522275-183522297 TCCTATTAGGTTATTACTAAGGG + Intergenic
1176849522 21:13902059-13902081 CCCCATGAGGTTCTGCCTCTTGG + Intergenic
1176942623 21:14942202-14942224 CTCCATTAAGTTGTACCTAAGGG + Intergenic
1178002822 21:28182637-28182659 CCCCACTGGGGCATGCCTAATGG + Intergenic
1179355945 21:40659729-40659751 CCCCATTAGGCTGTACCTGATGG + Intronic
1179355948 21:40659731-40659753 CCCCATCAGGTACAGCCTAATGG - Intronic
949341116 3:3031985-3032007 CCCCCTTACATTATGCCTAGAGG - Intronic
952510013 3:34043502-34043524 CCAAATCAGGTGATGCCTAAAGG - Intergenic
955098098 3:55820021-55820043 GCCCATGAGGTTGTTCCTAAAGG + Intronic
957593810 3:82234222-82234244 ACCCATCTGGTTATGACTAAGGG + Intergenic
958563832 3:95781789-95781811 CTCCATTAGGTAGTGCCCAATGG - Intergenic
970072755 4:12180157-12180179 CCCCATTAAGTCATGCATGATGG + Intergenic
970763025 4:19514641-19514663 TGTGATTAGGTTATGCCTAATGG + Intergenic
971795800 4:31226530-31226552 CCCTATTAAGCTTTGCCTAAGGG + Intergenic
977169546 4:93743754-93743776 TCCCATTAGGTGGGGCCTAATGG - Intronic
999118209 5:149183640-149183662 CACCATCAGGTCATGCCTCAGGG + Intronic
999479356 5:151932346-151932368 CCCTAATAGGCTATGCCCAAGGG - Intergenic
1011459476 6:87588696-87588718 CCTCAATAGTTTATGCCTTAAGG + Intronic
1012898694 6:104981955-104981977 CACCTTTATGTAATGCCTAAAGG - Intronic
1013872405 6:114781254-114781276 TCCAATTATGTTCTGCCTAAAGG - Intergenic
1023602657 7:41895426-41895448 CCCCATAAGGTTATTTATAAGGG - Intergenic
1028852666 7:95553689-95553711 CTCCATTGGATTATGCATAAGGG - Intergenic
1056456365 9:86764692-86764714 CCCCACTTGGATATTCCTAAGGG - Intergenic
1190784382 X:53630119-53630141 TCCCATTAGTTTATGCTTCAGGG - Intronic
1197565453 X:128078848-128078870 CCCCAATATGCTATGCCGAAAGG - Intergenic