ID: 1088297937

View in Genome Browser
Species Human (GRCh38)
Location 11:108321381-108321403
Sequence AATGCTTTCCAGCTCTCCAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088297937_1088297941 -5 Left 1088297937 11:108321381-108321403 CCATTGGAGAGCTGGAAAGCATT 0: 1
1: 0
2: 1
3: 25
4: 263
Right 1088297941 11:108321399-108321421 GCATTGGGGAGCTTTTCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088297937 Original CRISPR AATGCTTTCCAGCTCTCCAA TGG (reversed) Exonic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902685965 1:18077872-18077894 AAAGCTTTTAAGCTCACCAAGGG - Intergenic
904833569 1:33320768-33320790 TCTGCTTTCCGGCTCGCCAAGGG + Intronic
905282592 1:36858778-36858800 AAGGCTCTCCAGCTCGCCCAAGG + Intronic
905967499 1:42111513-42111535 AATGTTTACCAGCTCTCTACTGG - Intergenic
906580520 1:46931613-46931635 AATGCTCTCCAGTTCTCTAGTGG + Intronic
907245627 1:53106764-53106786 AATGCTGTGCAGCTGACCAACGG + Intronic
907354142 1:53858270-53858292 AATGCTTTCCAGTTCCTTAATGG - Intronic
907607629 1:55834250-55834272 ATTGCTTTGAAGGTCTCCAATGG - Intergenic
908392934 1:63699722-63699744 AATGTTCTCCAGCTCTGCAGAGG + Intergenic
909438768 1:75673915-75673937 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
910455519 1:87393524-87393546 GAGGTTTTCCAGCTCTCCAGTGG + Intergenic
912472137 1:109913078-109913100 AATGCTTGCCAGCTCTTCTGGGG - Intronic
912791258 1:112653413-112653435 AATGCCTTCCAGCTTTCTGAAGG - Intronic
916321957 1:163513846-163513868 AAGGCTTTCCAGCTATTCAAGGG - Intergenic
916667609 1:166980726-166980748 AATGCTCTTCTGGTCTCCAAAGG - Intronic
917727031 1:177838002-177838024 CATGATTTCGACCTCTCCAAAGG + Intergenic
918476105 1:184927304-184927326 AAGGCTTTCCAGGTATTCAAAGG + Intronic
921601153 1:217108325-217108347 CATTCTTTGCAGCTCTCCGATGG + Intronic
921929215 1:220741651-220741673 AAAGCTTTCCAGGTATTCAAAGG + Intergenic
923131185 1:231076109-231076131 AATGGTTTACAATTCTCCAAAGG + Intergenic
924135845 1:240965898-240965920 AATGCTTTCCAGCTCCCATCTGG - Intronic
924191056 1:241553077-241553099 AATGTCTTACAGATCTCCAAAGG + Intronic
924443263 1:244104298-244104320 AATGCTTTCTGTCTCTACAATGG + Intergenic
1063612830 10:7577192-7577214 AATGCATTCCCTCTCACCAATGG - Intronic
1065680041 10:28220814-28220836 AATGCTTCCCAGTTTTGCAACGG + Intronic
1067263427 10:44714774-44714796 AACCCTTTCCAGATCTCCATAGG - Intergenic
1071483718 10:86083932-86083954 AAAGCTTTCCAGGTGTCCCAAGG + Intronic
1072843152 10:98796983-98797005 AATGCTTTCCAGGTATTCAAAGG - Intronic
1073677366 10:105663314-105663336 AATGCTTTCCAGGTCTCCATGGG + Intergenic
1074203887 10:111264472-111264494 AATACTATCCAGCTTTGCAAAGG - Intergenic
1077427615 11:2491103-2491125 AAAGCTTTCCAGGTATTCAAAGG - Intronic
1078523985 11:12086673-12086695 CCTGCTTCCCATCTCTCCAAGGG + Intergenic
1078608434 11:12797997-12798019 TATGCTTTCCATCCCTGCAATGG + Intronic
1079682104 11:23310431-23310453 AATTTTTTCTAGCTCTTCAATGG + Intergenic
1079921972 11:26443862-26443884 ACTCCTTTCCCTCTCTCCAAAGG + Intronic
1080096976 11:28419508-28419530 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1081770196 11:45645665-45645687 AAAGCTTGCCAGTTCACCAAGGG - Intergenic
1082115265 11:48321204-48321226 TATGCTTTCCGCCTCTCCAAGGG - Intergenic
1083557134 11:63639312-63639334 AATTCTTACTAGCTCTGCAAAGG - Intronic
1086847730 11:91773204-91773226 AAGGCTTTCCAGTTATTCAAAGG + Intergenic
1087006323 11:93475711-93475733 AATTATTTCCAGCTATTCAATGG - Intergenic
1087286789 11:96272699-96272721 GCTGCATTCCAGGTCTCCAAAGG - Intronic
1088297937 11:108321381-108321403 AATGCTTTCCAGCTCTCCAATGG - Exonic
1090111338 11:123911992-123912014 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1093562481 12:20558792-20558814 AAAGCCTTCCAGCTTTTCAAGGG + Intronic
1094041357 12:26124033-26124055 CATTCTTTGCTGCTCTCCAAGGG - Intronic
1094125461 12:27018384-27018406 TTTGCTTCTCAGCTCTCCAATGG - Intergenic
1095242962 12:39882541-39882563 CACACTTTCCAACTCTCCAAAGG + Intronic
1097770073 12:63572943-63572965 AAGGCTTTCCAGGTATTCAAAGG - Intronic
1098395445 12:70011847-70011869 AATGCTTTCCAGGTATTCAAAGG - Intergenic
1099992362 12:89737578-89737600 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1101607609 12:106259411-106259433 AAGGCTTTCCAGGTATTCAAAGG - Intronic
1104568948 12:129908582-129908604 ATCGAATTCCAGCTCTCCAAGGG - Intergenic
1104568964 12:129908666-129908688 ATCGAATTCCAGCTCTCCAAGGG - Intergenic
1107142757 13:37020362-37020384 AATGCTTTCTAGCTTACCAAAGG + Intronic
1107210997 13:37853416-37853438 AAGGCTTTCCAGCTATTCACAGG - Intronic
1107795362 13:44046161-44046183 AAGCCTTTCCAGCTCTCCCTCGG - Intergenic
1108332559 13:49404383-49404405 AAGGCTTTCCAGATATTCAAAGG - Intronic
1108858158 13:54820918-54820940 AAGCCTTTCCAGCTATTCAAAGG - Intergenic
1108996925 13:56746654-56746676 AATGCTTTCCAGGTATTCAAAGG + Intergenic
1109685964 13:65819793-65819815 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1111146822 13:84192919-84192941 AATGCTGTCCAGTTTTCTAAAGG - Intergenic
1113254047 13:108487133-108487155 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1113448761 13:110390614-110390636 AATGGTTTCCAGCTGCCCTATGG - Intronic
1113735449 13:112675263-112675285 AATTTTTTCCAGCTCTTCAAGGG - Intronic
1114985010 14:28216585-28216607 AATTCTTTCCAGGTATCCAAGGG + Intergenic
1116392827 14:44414023-44414045 AATGCTTTCCAGTTATTCAAAGG - Intergenic
1116495254 14:45552602-45552624 AATGCTTTCCAGAAATTCAAAGG + Intergenic
1116785439 14:49282570-49282592 ATTTTTTTCCAGCACTCCAAAGG - Intergenic
1116870903 14:50068488-50068510 AAGGCTGTGCAGCTCTCCAAAGG + Intergenic
1116889263 14:50250864-50250886 AAGGCTTTCCAGGTATTCAAAGG - Intronic
1116998841 14:51351995-51352017 AATGCTTTCCATCTTATCAAAGG + Intergenic
1117418493 14:55519886-55519908 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1117798534 14:59419288-59419310 ATTACTTTCCAGCTCTCGAGAGG - Intergenic
1118522689 14:66604163-66604185 TATACTTTGCAGCTCTACAAAGG - Intronic
1118925341 14:70186755-70186777 CATGCATTGCAGGTCTCCAAAGG - Intronic
1118944707 14:70373625-70373647 AATGCTTTCCAGATCCCAGAAGG + Intronic
1119524598 14:75312364-75312386 AATTCTCTCCAACTCTCCTACGG - Intergenic
1125335667 15:38623842-38623864 AATGGTTTCCACCTCTCGATAGG - Intergenic
1125702171 15:41696477-41696499 CATGCTTTCCACATCTCGAAAGG + Exonic
1126099294 15:45110236-45110258 AAATCTCTCCAGCTCTCCTAAGG - Intronic
1126285662 15:47008355-47008377 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
1126710476 15:51449890-51449912 AATGCTTTAAAGCTTTCTAATGG + Intronic
1127493380 15:59485628-59485650 AAGGCTTTCCAGATATTCAAAGG - Intronic
1129561908 15:76578718-76578740 AATGTTTTCCAGGTATCCAAAGG - Intronic
1129769971 15:78196759-78196781 AATGCTATTCAGCTCTGAAAAGG + Intronic
1130173038 15:81536504-81536526 AATGCTTTCCGGGTATTCAAAGG - Intergenic
1131881149 15:96863625-96863647 AATCCTTTCCAGCTCACCCCAGG - Intergenic
1133664708 16:7955237-7955259 AATGTTTTCCAGCTTTTAAAAGG - Intergenic
1134370850 16:13622898-13622920 AATGCTTTCCTTCTCTGCATTGG - Intergenic
1137247572 16:46718063-46718085 AATGGTTTGTGGCTCTCCAAAGG + Intronic
1139004781 16:62557818-62557840 AAGGCTTTCCAGTTATTCAAAGG + Intergenic
1139065850 16:63313613-63313635 AGTGCTTTTCAGCTATGCAAGGG - Intergenic
1139111271 16:63893677-63893699 AATGCTTTCTAACTCTCCCCAGG - Intergenic
1139639733 16:68282536-68282558 AATGCTCTCCAACACTCCAGGGG - Intronic
1140026333 16:71293454-71293476 ATTGATTTCCAGCTCCCCTATGG - Intergenic
1141002017 16:80317312-80317334 AAGGCATTCCAGCTTCCCAAAGG + Intergenic
1147455132 17:40532834-40532856 ATTGCTTTACTGCTTTCCAAAGG + Intergenic
1149506749 17:57200744-57200766 AATGCTCACCAGGTCTCCACTGG - Intergenic
1152257140 17:79246704-79246726 AAGAGTTTCCATCTCTCCAAGGG - Intronic
1153049636 18:889650-889672 AATTCTTTCCAGCTTTACAGTGG + Intergenic
1156579889 18:38362748-38362770 ACTGCTTTCCAGAACTCCAGTGG - Intergenic
1157141274 18:45109458-45109480 CATGCATTTCAGCTCTCCACTGG + Intergenic
1157471397 18:47991720-47991742 AATGCTTTTCATCCCTTCAAAGG + Intergenic
1159648212 18:70944136-70944158 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1166242609 19:41504511-41504533 ATTGCTTTCCATATCGCCAAGGG - Intergenic
1166945424 19:46393356-46393378 AATGCTTTCCCTCCCTCCCATGG - Intergenic
1167813813 19:51860544-51860566 AATTCTTTCCTGCTATGCAATGG + Intronic
925588124 2:5483645-5483667 AATGCTTTCTGGATCTGCAAGGG + Intergenic
926993616 2:18708556-18708578 AATGCTTTCCATCCCTCCCTGGG - Intergenic
927114845 2:19889687-19889709 AAGGGTTTCCAGCTCCCCAGGGG - Intergenic
927162592 2:20281910-20281932 AATGCTTGCCAGTTTTCTAAGGG - Intronic
928749589 2:34456739-34456761 AAGGCTTTCCAGGTATTCAAGGG + Intergenic
930944759 2:57060818-57060840 AAGGCTTTCCAGATATTCAAAGG + Intergenic
930981122 2:57527797-57527819 AAAGCTTTCCAGGTATTCAATGG + Intergenic
932292827 2:70596845-70596867 AATGCTTGCCAGCCCTAGAAAGG - Intergenic
933485183 2:82912354-82912376 AATGCTTTCCAGGTATTCAAAGG - Intergenic
936925482 2:117731952-117731974 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
936940256 2:117877619-117877641 AAGGCTTTCAAGGTATCCAAAGG + Intergenic
937301517 2:120845587-120845609 TTTGCTTTCCAGGTCTCCCAGGG - Intronic
939023282 2:136983437-136983459 AATGCTTTGAAGACCTCCAAAGG - Intronic
939686200 2:145203956-145203978 TATGTCTTCCAGGTCTCCAAAGG - Intergenic
940127997 2:150348829-150348851 AATACCTTCCTGCTCTCCAGAGG - Intergenic
941851658 2:170189978-170190000 AAGGCTTTCCAGGTATTCAAAGG + Intronic
943831892 2:192473549-192473571 AAAGCTTTCCAGATATTCAAAGG - Intergenic
943933717 2:193886812-193886834 AAGGCTTTCCAGTTATTCAAAGG - Intergenic
945258557 2:207823234-207823256 AATGCTTTCCATCACACCAGCGG + Intergenic
945418968 2:209610667-209610689 TATTCTTTCCAGTTCTCCTACGG + Intronic
945645068 2:212481791-212481813 AATACTTTACAGCTCTGCAACGG - Intronic
947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG + Intergenic
1169188486 20:3640915-3640937 AATGTTATCCAGCCTTCCAAAGG + Intronic
1170863961 20:20136888-20136910 AAGGCTTTCCAGGTATTCAAAGG + Intronic
1171417977 20:24996318-24996340 GATCTTTTCCAGCTCTCCAGGGG - Intergenic
1172358318 20:34294972-34294994 AATGATTAACAGCTCTCCTAAGG - Intronic
1172818456 20:37710204-37710226 AAAGCTTTCCAGATTTCAAAAGG - Intronic
1173352644 20:42259443-42259465 ATGGATTTCCAGCTCACCAACGG - Intronic
1179839726 21:44063570-44063592 AATCCGTTCCAGCTCTTCACTGG - Exonic
1180628058 22:17207698-17207720 ATTGGCTTCTAGCTCTCCAATGG + Intronic
1181656309 22:24302740-24302762 AATGCTTTACTGCTCTCCCAGGG - Intronic
1181692388 22:24571242-24571264 AATGTTTTTCAGCTCACCCAAGG + Intronic
1183169704 22:36178436-36178458 GATGCTTTACAGCTCTCGAGAGG + Intergenic
951387447 3:22059631-22059653 AATGCCTTTGAGTTCTCCAATGG + Intronic
954036568 3:47854020-47854042 CACGCTTTCCAGCTCCCCAGTGG - Intronic
955787299 3:62553984-62554006 AATGCTGGCCAGCTCTCTAGGGG + Intronic
958632167 3:96699054-96699076 AAGGCTTTCCAGGTGTTCAAAGG + Intergenic
958876827 3:99625682-99625704 AAGGCTTTCCAGATATTCAAAGG - Intergenic
959498471 3:107078178-107078200 AAATCTTTCCAGCTACCCAAAGG + Intergenic
960153404 3:114274141-114274163 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
960654935 3:119992542-119992564 AAAGCTTTCCAGCTATCCTCAGG - Intronic
961709215 3:128814269-128814291 AAAGCTTTTCATCTCTCCAGGGG + Exonic
962038637 3:131682280-131682302 AAGGCTTTCCAGGTATTCAAAGG + Intronic
962638680 3:137360655-137360677 AATGCTTTCCAGGTATTCAAGGG + Intergenic
963330662 3:143910952-143910974 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
963705963 3:148688684-148688706 AATACCTTGAAGCTCTCCAAAGG + Intergenic
964258782 3:154810713-154810735 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
964498977 3:157327204-157327226 AATGCTTTCCACCACCACAAGGG + Intronic
964992399 3:162829539-162829561 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
965326127 3:167306912-167306934 AATGCTTTACAGCTTTACAAAGG + Intronic
965343695 3:167520916-167520938 AAAGCTTTCCTCCCCTCCAATGG - Intronic
965653571 3:170959902-170959924 AAAGCTTTCCAAGTATCCAAAGG - Intergenic
965764522 3:172115845-172115867 AATACTTTGCAGCTGTGCAAAGG + Intronic
966429564 3:179817085-179817107 AATGGTTTGTAGTTCTCCAAAGG - Intronic
966766403 3:183466725-183466747 ATTTGTTTCCAGCTCTCCAAGGG + Intergenic
967044989 3:185728211-185728233 ACTGCCTTCCAGCTTTCCCACGG + Intronic
967267672 3:187705001-187705023 CATGCTTCCCAGCACCCCAAAGG + Intronic
967655669 3:192044832-192044854 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
968218619 3:196915909-196915931 AAGGCTTTCCAGGTATTCAAAGG - Intronic
970437697 4:16051418-16051440 AATGTTTCCCAGCACTCAAAAGG - Intronic
971095545 4:23398504-23398526 AAGGCTTTCCAGATATTCAAAGG + Intergenic
971331968 4:25689051-25689073 ACTCCTACCCAGCTCTCCAAGGG - Intergenic
972424480 4:38919529-38919551 AATACTCTCCAGGTCACCAAAGG - Intronic
976072911 4:81262071-81262093 AATTCTTTACACCTCTGCAAAGG + Intergenic
976161345 4:82202281-82202303 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
976832151 4:89327624-89327646 AATGCTTTCTGGACCTCCAAGGG + Intergenic
976943638 4:90738253-90738275 AAGGCTTTCCAGGTATTCAAAGG + Intronic
977341633 4:95765106-95765128 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
977644442 4:99396177-99396199 AATGCTTTCCAGATATGAAAGGG - Intergenic
978340978 4:107720773-107720795 AATGTTTTACAGCTTTGCAAAGG + Intergenic
979106260 4:116691707-116691729 ACTGCTTTTGAGCTGTCCAAAGG + Intergenic
979156235 4:117393393-117393415 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
979780510 4:124645920-124645942 AATGCATTTCAACTTTCCAATGG - Intergenic
980172286 4:129305041-129305063 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
981569112 4:146132650-146132672 AATGATTTCTCTCTCTCCAAAGG - Intergenic
982065349 4:151649908-151649930 AATGCCCTCCTGCTCTTCAAAGG + Exonic
982683247 4:158458447-158458469 AAGGCTTTCCAGGTATTCAAAGG + Intronic
983017368 4:162629347-162629369 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
983441111 4:167786060-167786082 AATGCTTGCTAGATCTCAAATGG - Intergenic
984444330 4:179815698-179815720 AATGCTTCCCAATTCTGCAATGG + Intergenic
984739643 4:183148549-183148571 ATGGCTTTCCTCCTCTCCAAAGG + Intronic
987616248 5:20277514-20277536 AAGGCTTTCCAGGTATTCAAAGG - Intronic
988608283 5:32701657-32701679 AAGGCTTTCCAGGTATTCAAAGG + Intronic
989451168 5:41588056-41588078 AATGCTTCATGGCTCTCCAAAGG + Intergenic
993932059 5:93953297-93953319 AAGGCTTTCCAGGTATCCGAAGG + Intronic
994457405 5:100028572-100028594 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
995028834 5:107456549-107456571 AATGTTTTTCAGCTCTCTAGAGG - Intronic
995290127 5:110442770-110442792 AAGGCTTTCCAGGTATTCAAAGG + Intronic
995996112 5:118302003-118302025 AATGCTTTCCTACACTCCATTGG + Intergenic
996906619 5:128608412-128608434 AAGGCTTTCCAACTATTCAAAGG + Intronic
998253919 5:140570652-140570674 AATGGTTTGCAGCTCTCCTTGGG + Intronic
1000841350 5:166222549-166222571 AAAGCTTTCTTGCTCTCCTAAGG + Intergenic
1000911538 5:167029004-167029026 AATGCTTTTCAGAGCTTCAACGG - Intergenic
1001138853 5:169126113-169126135 GCTGCCTTCTAGCTCTCCAATGG + Intronic
1001215277 5:169850260-169850282 AAGGCGTTCAAGCTCTCTAATGG - Intronic
1001921664 5:175605116-175605138 AATGGTTTGTGGCTCTCCAAAGG + Intergenic
1005964947 6:30720723-30720745 AATGATTCCCAGCTTTCCAAAGG - Intronic
1006142573 6:31939155-31939177 AATGCTTTCCTACTCTTCCAGGG + Intronic
1008685111 6:53917096-53917118 AATACATTCCTGCTTTCCAAAGG - Intronic
1009727985 6:67559272-67559294 AAGGCTTTCCAGATATTCAAAGG + Intergenic
1013014221 6:106146321-106146343 AATGGAAGCCAGCTCTCCAAAGG - Intergenic
1013887684 6:114989576-114989598 TCTGCTTTCCAGCTTTCCAAAGG + Intergenic
1014612921 6:123567028-123567050 AATTAATTGCAGCTCTCCAATGG - Intronic
1016623681 6:146142030-146142052 AAGGCTTTCCAGGTATTCAAAGG + Intronic
1017761494 6:157573295-157573317 GATGCTTTCCAGCTCTGGGAGGG - Intronic
1018118863 6:160615860-160615882 CTTGCTTTCCAGCTGTGCAAGGG + Intronic
1018119467 6:160621406-160621428 CTTGCTTTCCAGCTGTGCAAGGG + Intronic
1018120067 6:160626952-160626974 CTTGCTTTCCAGCTGTGCAAGGG + Intronic
1018120671 6:160632498-160632520 CTTGCTTTCCAGCTGTGCAAGGG + Intronic
1018121265 6:160638045-160638067 CTTGCTTTCCAGCTGTGCAAGGG + Intronic
1018121867 6:160643590-160643612 CTTGCTTTCCAGCTGTGCAAGGG + Intronic
1019066248 6:169301496-169301518 AATGCTCTGCAGATCTACAAGGG + Intergenic
1020381494 7:7552243-7552265 AATCTTTTCCAGCTCTGCATAGG + Intergenic
1020994662 7:15248367-15248389 ATAGCTTTCCACCTCTCCATGGG - Intronic
1021214459 7:17899951-17899973 AAGGCTTTCCAGGTATTCAAAGG + Intronic
1022223451 7:28339267-28339289 AAGGCTTTCCAGGTATTCAAAGG + Intronic
1022366830 7:29729829-29729851 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
1027646105 7:80800263-80800285 AATTGTTTCCAGCTTTCCTAAGG + Intronic
1028699756 7:93763656-93763678 CAGGCTTTCCTGTTCTCCAATGG - Intronic
1029825440 7:103187630-103187652 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1031566016 7:123297461-123297483 AAGGCTTTCCAGATATTCAAAGG - Intergenic
1031722077 7:125188336-125188358 AATGCTTTCCAAGTATTCAAAGG - Intergenic
1032138646 7:129306737-129306759 AAGGCTTTCCAGATATTCAAAGG + Intronic
1032586103 7:133148074-133148096 AGTGGTTTCCAGGTATCCAAAGG - Intergenic
1032850067 7:135786792-135786814 AATGCTATGCAGCTCTAAAAAGG - Intergenic
1032939242 7:136769116-136769138 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1033489090 7:141824271-141824293 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
1037354008 8:17998345-17998367 AAAGCTTTCCAGGTATTCAAAGG + Intronic
1039042848 8:33424539-33424561 GATGCTTTCCAACCCTCGAAAGG + Intronic
1040566671 8:48573645-48573667 AATGCTTTTTAGATCTCCATTGG + Intergenic
1040604943 8:48922110-48922132 AATGCTTTGTAGCCCTCTAAAGG + Intergenic
1041851784 8:62401567-62401589 AAGGCTCTCCAGGTATCCAAAGG + Intronic
1043824339 8:84907006-84907028 AATTCTTACCAGCTTTCCAAAGG - Intronic
1044140469 8:88645049-88645071 ATTTCTTTCCAGGTCTCCACAGG + Intergenic
1044870852 8:96618516-96618538 AATGCTTCCCAGATCCCCCAAGG - Intergenic
1046215449 8:111140379-111140401 AAAGCTTTCCAGATATTCAAAGG + Intergenic
1047122546 8:121922132-121922154 AATGCTGTCCAGCTCATAAAAGG - Intergenic
1047772982 8:128045337-128045359 CATGTTTTCCAGGTCTTCAATGG - Intergenic
1047901232 8:129424018-129424040 AAGGCTCTCCAGGTCTTCAAAGG - Intergenic
1047933769 8:129754461-129754483 AAGGCTTTCCAGGTATTCAAAGG - Intronic
1048402468 8:134084606-134084628 GATGCTTTACAGCTCTCCACAGG + Intergenic
1050248309 9:3714568-3714590 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1051047319 9:12889814-12889836 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1052573655 9:30264039-30264061 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
1060045272 9:120335482-120335504 AATACTATCCAGCTATCAAAAGG + Intergenic
1062510441 9:136902404-136902426 AATAGTTTCCAGCTCTGCACTGG + Intronic
1185812667 X:3125185-3125207 AATTCGTTCCAGCTCACCATTGG - Intergenic
1185921646 X:4099744-4099766 AATGGTTTTCAGCTCTTAAACGG - Intergenic
1187215047 X:17268021-17268043 AATGCTTTAGAGCTCTCCACAGG - Intergenic
1187261943 X:17693062-17693084 CATGCTTTCCCATTCTCCAAAGG + Intronic
1187315019 X:18184659-18184681 AAGGCTTTCCAGGTATTCAAAGG - Intronic
1187488625 X:19728553-19728575 AATTCTTTGAAGCTCTCCAGAGG + Intronic
1187661596 X:21552422-21552444 AATACTTACCAGCTTCCCAATGG + Intronic
1188192094 X:27183405-27183427 AAAGCTTTCCAGATATTCAAAGG - Intergenic
1189013295 X:37069816-37069838 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
1189055373 X:37694089-37694111 GATGCTTTCCAGCAGGCCAATGG - Intronic
1189615078 X:42774801-42774823 AATACCTTGCAGCTCCCCAAAGG + Intergenic
1190374197 X:49773813-49773835 AAGGCTTTCCAGGTTTTCAAAGG + Intergenic
1190460337 X:50667047-50667069 ATTGCTTTCCAGCTAATCAAAGG - Intronic
1190899135 X:54651592-54651614 AAAGCTTTCCATGTATCCAAAGG - Intergenic
1191119037 X:56884177-56884199 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
1192505493 X:71679501-71679523 AAGGCTTTCCAGATATTCAAAGG + Intergenic
1193448498 X:81636808-81636830 AAGGCTTTCCAGGTATTCAACGG - Intergenic
1193648949 X:84106992-84107014 AATGCTCATCAGCTCTTCAAAGG - Exonic
1193911850 X:87316174-87316196 AATGTTTTCCAGGTATTCAAAGG + Intergenic
1194257382 X:91651875-91651897 AAGGCTTTCCAGATATTCAAAGG + Intergenic
1194526624 X:94984494-94984516 GAGGCTTTCCAGGTCTTCAAAGG - Intergenic
1195090002 X:101449859-101449881 AAGGCTTTCCAGGTATTCAAAGG + Intronic
1195266266 X:103183176-103183198 AATGGTTTGCGGCTCTCCAAAGG - Intergenic
1195964919 X:110421186-110421208 AATGCTTTCTAGCCCTTCAAGGG + Intronic
1196368881 X:114952947-114952969 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1196576472 X:117324896-117324918 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
1196619752 X:117807988-117808010 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1197358378 X:125466436-125466458 AATGTTTTCCAGATTTTCAATGG + Intergenic
1197487570 X:127073492-127073514 AAGGCTTTCCAGGTATTCAAAGG + Intergenic
1199591154 X:149469562-149469584 AATGTTGTCCAGCTCTCAAGTGG + Intergenic
1199845422 X:151689281-151689303 AAGGCTTTCCAGGTATTCAAAGG - Intergenic
1199934751 X:152561892-152561914 AATGGTTTCCAGCTCTTAAGAGG - Intergenic
1200576039 Y:4890821-4890843 AAGGCTTTCCAGATATTCAAAGG + Intergenic
1200782915 Y:7232860-7232882 ATTGCTTTTCAGCTCTCCAGCGG + Intergenic
1201268862 Y:12235070-12235092 AATTCTTTCCAGCTGACCATTGG + Intergenic