ID: 1088303750

View in Genome Browser
Species Human (GRCh38)
Location 11:108386615-108386637
Sequence ATGGAAAAGCACCAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088303748_1088303750 -8 Left 1088303748 11:108386600-108386622 CCTTCTGTGAGGATGATGGAAAA 0: 1
1: 0
2: 1
3: 23
4: 246
Right 1088303750 11:108386615-108386637 ATGGAAAAGCACCAAGAGGCAGG 0: 1
1: 0
2: 2
3: 37
4: 302
1088303743_1088303750 29 Left 1088303743 11:108386563-108386585 CCTGAGAAGAGGTAGAATAGGGA 0: 1
1: 0
2: 1
3: 20
4: 204
Right 1088303750 11:108386615-108386637 ATGGAAAAGCACCAAGAGGCAGG 0: 1
1: 0
2: 2
3: 37
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088303750 Original CRISPR ATGGAAAAGCACCAAGAGGC AGG Intronic
900030755 1:370928-370950 AGGGAAAATCACCATCAGGCTGG - Intergenic
900051371 1:599602-599624 AGGGAAAATCACCATCAGGCTGG - Intergenic
901677466 1:10894464-10894486 TTGAAAAAACACCATGAGGCCGG - Intergenic
902531343 1:17092650-17092672 ATAGAAAAGCATAAAGAGGCTGG + Intronic
902860552 1:19242225-19242247 ATGGAACACCAACAAGAGACAGG + Intronic
904106764 1:28091134-28091156 ATGGGAAAGTACAAAGAGGATGG - Intergenic
907697667 1:56749865-56749887 AAAGAAAAGCACCCACAGGCCGG - Intronic
908006498 1:59734053-59734075 GTGAAACAGAACCAAGAGGCAGG - Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908626432 1:66049014-66049036 ATGTAAAAGCACCAAGTTCCGGG - Intronic
909702770 1:78545522-78545544 ATCAAAAAGCTCCATGAGGCTGG - Intergenic
910436291 1:87209278-87209300 ATGGAAAACCACCATCAGCCTGG + Intergenic
911504641 1:98733487-98733509 AAGGAAAAGGACAGAGAGGCAGG - Intronic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
914400373 1:147314424-147314446 AGGGTAAACCTCCAAGAGGCTGG + Intergenic
916541436 1:165759119-165759141 ATGGAAATCCACCAAGGGGTAGG - Intronic
917483856 1:175436698-175436720 ATGGAAAACCAAAAAAAGGCAGG + Intronic
917858170 1:179119243-179119265 ATAAAAAACCAACAAGAGGCCGG + Intronic
919580330 1:199364490-199364512 ATGGAAAAGAAAAAAAAGGCAGG - Intergenic
919873620 1:201844021-201844043 ATGCAAAATCACCATTAGGCAGG + Intronic
920439254 1:205967707-205967729 CTGGCAAAGCACCAAGAGCATGG + Intergenic
921824359 1:219655450-219655472 ATGGAAATTAAGCAAGAGGCAGG - Intergenic
922814073 1:228436885-228436907 AGGCACAAACACCAAGAGGCAGG - Intergenic
922860209 1:228810118-228810140 CTGGAAAAACTCCAAGAGGATGG - Intergenic
922887746 1:229032804-229032826 CTGAAAATGCACCAAGAAGCTGG - Intergenic
923260659 1:232264736-232264758 ATGGAAAAAGACCCAGAGGAAGG - Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923701883 1:236307518-236307540 AGGGAAAGGCCCCAAGAGGCAGG - Intergenic
924278676 1:242413721-242413743 ATGGAAAGGTAGGAAGAGGCAGG + Intronic
1064104635 10:12490550-12490572 AAGAAAAACCACAAAGAGGCTGG + Intronic
1064265744 10:13823888-13823910 CTGGAAAAGTAGCAAGTGGCTGG - Intronic
1064744449 10:18464881-18464903 GTGGGAAAGAACCAAGAGGAAGG + Intronic
1065768402 10:29053650-29053672 ATGTAATAGATCCAAGAGGCTGG - Intergenic
1067219094 10:44329796-44329818 ATTTAAAAGCTCCCAGAGGCTGG + Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070998025 10:80803344-80803366 ATGGTAAAGAAACAGGAGGCAGG + Intergenic
1071194020 10:83136179-83136201 ATAGAAAACCACAAATAGGCTGG + Intergenic
1076407421 10:130221927-130221949 ATGGAGACACACCCAGAGGCCGG - Intergenic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1076900922 10:133336974-133336996 ATGGAAACGCGGCTAGAGGCGGG + Intronic
1078390820 11:10934012-10934034 TTGGGACAGCACCAAGAAGCTGG - Intergenic
1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG + Intronic
1078944269 11:16046269-16046291 ACAGAAAAACACCAATAGGCAGG + Intronic
1079134947 11:17771129-17771151 ATGGAAAAGAGCAAAGAGCCTGG + Intronic
1079730768 11:23936237-23936259 ATGCAAAAACACAAAGAGGTGGG - Intergenic
1080719111 11:34831980-34832002 AAGGTGAGGCACCAAGAGGCTGG + Intergenic
1082769519 11:57196075-57196097 ATAGAAAGACACCAAGGGGCAGG - Intergenic
1083691015 11:64409003-64409025 ATGGAAAATTACCAAGGGGTAGG - Intergenic
1084211444 11:67625341-67625363 ATGCAAAAACACAAAGAGGTGGG + Intergenic
1084362780 11:68679783-68679805 ATGGAAAAGGACCAAAAAGGGGG + Intergenic
1085808785 11:79661255-79661277 AAGGAAAGCCACCAATAGGCAGG - Intergenic
1086326628 11:85707926-85707948 ATGGAAAAACCCCATGAGCCAGG + Intronic
1087017763 11:93571317-93571339 ATGGAAAAGCAAGCAGAGACAGG + Intergenic
1088303750 11:108386615-108386637 ATGGAAAAGCACCAAGAGGCAGG + Intronic
1089914994 11:122145598-122145620 ATGGAAAAATACCAAAAGACTGG - Intergenic
1090105626 11:123851603-123851625 ATGGAAAAGCACCAAAAGAGTGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092058943 12:5532340-5532362 ATGGAAGAGAACTAAGAGACAGG + Intronic
1092472757 12:8793611-8793633 ATGCAAAAACACAAAGAGGTGGG + Intergenic
1092979301 12:13777611-13777633 ATGGAAAGGCACCAAGCGTTAGG - Intronic
1093680492 12:21996538-21996560 ATGGAAAAGCAACAGGAGACAGG - Intergenic
1094526685 12:31235724-31235746 ATGGAAAGACATCAGGAGGCAGG + Intergenic
1095487792 12:42702590-42702612 ATGCAAAAGCACTAAGTGGGTGG + Intergenic
1097596326 12:61636855-61636877 ATGGATAATCACAAAGAGGCAGG + Intergenic
1098870811 12:75815040-75815062 ATGGAAAGGCACAGTGAGGCAGG - Intergenic
1099588118 12:84546963-84546985 ATTGAAAATTACCAAGAGACAGG - Intergenic
1100605814 12:96151144-96151166 AGGAAAAGGCACCAAGAAGCTGG + Intergenic
1103167745 12:118784770-118784792 ATGGTAAAGCACCGAGGGGCTGG + Intergenic
1103681272 12:122696013-122696035 ATGGAAAATCACCACGAGTCAGG + Intergenic
1103683002 12:122709438-122709460 ATGGAAAATCACCACGAGTCAGG + Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106288656 13:28340598-28340620 AGGGAAAAGCACCAAAAGGAAGG - Intronic
1107187112 13:37536537-37536559 ATAGCAAAGAAGCAAGAGGCTGG + Intergenic
1108415294 13:50192311-50192333 ATGGAAATGCAGGAAGAGCCTGG - Intronic
1108450460 13:50557463-50557485 ATGGAAAAGCAAAAAAAGTCAGG + Intronic
1108809287 13:54201503-54201525 AAGGAACAGCAGCAAGAGGATGG - Intergenic
1110140495 13:72123115-72123137 TTGTAAAACCAGCAAGAGGCTGG - Intergenic
1110288005 13:73772545-73772567 ATGAAAAAGCACCAAAGGGTAGG + Intronic
1111194209 13:84851239-84851261 CTGGAAAAGCAAAGAGAGGCAGG - Intergenic
1113364690 13:109665254-109665276 ATGGCAAAGAACCCACAGGCTGG + Intergenic
1113369321 13:109708177-109708199 AAACAAAAGCCCCAAGAGGCTGG + Intergenic
1113558210 13:111255386-111255408 ATGGGCAAGCAACATGAGGCAGG - Intronic
1115559289 14:34568768-34568790 GTGGAAAAGGACCAAGATGGGGG - Intronic
1117777626 14:59198780-59198802 ATTGCAAAGCACCAAAAGACAGG - Intronic
1117964268 14:61190653-61190675 GTGGAAACACAGCAAGAGGCAGG - Intronic
1119215873 14:72868678-72868700 ATGGAAAACCTCCAAGGAGCAGG + Intronic
1119226751 14:72950279-72950301 AGGGAAGGGCACCAAGAGGCAGG + Intronic
1120157682 14:81112076-81112098 CTGGAATGCCACCAAGAGGCAGG - Intronic
1120295744 14:82638015-82638037 ATTGAAAAGCAACAATAGGTTGG + Intergenic
1121140601 14:91538547-91538569 AGAGAACAGCACCAAGAGGATGG + Intergenic
1121827258 14:97020612-97020634 AGGGATAAGCACCCAGAGCCTGG + Intergenic
1122396974 14:101440794-101440816 ATGGAAAAACACCAATTGGATGG + Intergenic
1122800975 14:104229358-104229380 ACTGAAATGCACCGAGAGGCTGG + Intergenic
1124433912 15:29632226-29632248 TTGGAAAAGTAAAAAGAGGCAGG - Intergenic
1124920632 15:34022889-34022911 ATAGAAAAGAACAATGAGGCCGG + Intronic
1126790451 15:52216852-52216874 ATGGAAAAGAACACAGAGACAGG + Intronic
1126796760 15:52265921-52265943 ATGGAAAGGCAGCAAGTGCCTGG - Intronic
1128988378 15:72237677-72237699 ATGGAAAATTACCAGGAGGAGGG + Intergenic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131417378 15:92272449-92272471 AAGGGAATGCACCAACAGGCTGG - Intergenic
1131533043 15:93211057-93211079 ATGGAACAACACCAGCAGGCAGG + Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1134313131 16:13094061-13094083 ATGGAAAAGTACCAAGACACCGG - Intronic
1135116759 16:19730250-19730272 ATTTAAAATCAGCAAGAGGCCGG - Intronic
1136286018 16:29242685-29242707 ATGGAACTGAAACAAGAGGCAGG - Intergenic
1136629777 16:31483137-31483159 ATGGAGGAGCACACAGAGGCAGG + Exonic
1138444908 16:57057700-57057722 ATGGAAGAGGACCAAGAGGATGG + Intronic
1138671635 16:58620342-58620364 ATGTAAAAAGACGAAGAGGCTGG + Intronic
1138763529 16:59572215-59572237 AAGCAAAAGCAACCAGAGGCTGG - Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139656853 16:68393106-68393128 ATGAAAATGGACCAGGAGGCTGG + Intronic
1139785298 16:69387465-69387487 ATGGAAAAGCAGCCATGGGCCGG - Intronic
1140257018 16:73346216-73346238 CTGGAAAAGTTCCAAAAGGCAGG - Intergenic
1140890539 16:79281018-79281040 GTGAAAAAGCAGCAAGAGACAGG + Intergenic
1141283241 16:82647755-82647777 ATGGAAAAGCCAGAAGAGACAGG + Intronic
1141351406 16:83301381-83301403 ATGGAAAATCACAGAGAGGGAGG - Intronic
1142091356 16:88212878-88212900 ATGGAACTGAAACAAGAGGCAGG - Intergenic
1142817129 17:2435457-2435479 AGGGAAGAGAACCAAGAGGATGG + Intronic
1143140077 17:4737279-4737301 CTTGAAATGCATCAAGAGGCCGG + Intronic
1143537771 17:7551371-7551393 GTGGGGAAGCAGCAAGAGGCTGG - Intronic
1145028952 17:19490005-19490027 AGGGAAAAGCATCAAGAGTTTGG - Intergenic
1145391080 17:22456079-22456101 ATGCAAAAGCACCTTGTGGCAGG + Intergenic
1147681517 17:42250626-42250648 ATTGAAAATCATCACGAGGCCGG + Intronic
1149304499 17:55335049-55335071 GTGGAGGAGCACCAGGAGGCAGG - Intergenic
1149946631 17:60934860-60934882 ATGTAAAAACAGTAAGAGGCTGG + Intronic
1152447870 17:80356296-80356318 ATTCAAAAGCATCAACAGGCCGG - Intronic
1152619549 17:81355554-81355576 TTTGAAAAGCACAAATAGGCCGG + Intergenic
1152748694 17:82052623-82052645 CGGGAAAAGCACCAAGAGCTCGG - Intronic
1152948858 17:83214477-83214499 AGGGAAAATCACCATCAGGCCGG + Intergenic
1152993536 18:384853-384875 ATGGATAAGCACAGATAGGCTGG + Intronic
1155714814 18:28928198-28928220 AGGGAAAAGGACCAATAGGGTGG + Intergenic
1156156029 18:34302657-34302679 AAGGAAAAGCAGCAAGAGAAAGG + Intergenic
1156479996 18:37430363-37430385 TTGTAAAAGCACCCAGAGACTGG + Intronic
1156782300 18:40865395-40865417 ATGGAACAGTACTAAGAGGTGGG - Intergenic
1156839804 18:41598017-41598039 ATGGAAAATGACCTAGAGGGAGG - Intergenic
1156866136 18:41890770-41890792 CTGGAAGAGGACCTAGAGGCAGG + Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157597838 18:48874752-48874774 ATGGAAAGGGACCTGGAGGCAGG - Intergenic
1158229164 18:55234464-55234486 AGGGATGAACACCAAGAGGCTGG + Intronic
1158581569 18:58688852-58688874 ATTGAGAATCACCAAGAGGCCGG + Intronic
1159441345 18:68484655-68484677 CTGCAACAGCTCCAAGAGGCAGG - Intergenic
1159905056 18:74082438-74082460 ATGGCAAAGAAACAAGGGGCTGG + Intronic
1159922254 18:74237003-74237025 ATGGAATAGCACTGCGAGGCTGG - Intergenic
1161320726 19:3639724-3639746 AGTGAAAAGAACAAAGAGGCTGG - Intronic
1161712293 19:5855707-5855729 AGGTAAAAGCAAAAAGAGGCTGG - Intergenic
1162824368 19:13242590-13242612 AAGTAAAAGCATCAACAGGCCGG - Intronic
1163137068 19:15319634-15319656 ATTCAAAACCATCAAGAGGCAGG + Intronic
1164107773 19:22124065-22124087 CTCAAAAAGCAACAAGAGGCCGG - Intergenic
1165480087 19:36058053-36058075 ATATAAAAGTACTAAGAGGCCGG + Intronic
1166088398 19:40492143-40492165 ATGGGGAAGCAACAAGGGGCAGG + Intronic
1168184268 19:54688145-54688167 ATGGAAAAGAAACATGGGGCAGG + Intronic
1168262056 19:55200990-55201012 ATGGAATAGCATTAAGAGGTAGG + Intronic
1168428473 19:56258180-56258202 CTGTTATAGCACCAAGAGGCGGG - Intronic
925279607 2:2673827-2673849 AGGCAAAATCACCAGGAGGCAGG + Intergenic
925859861 2:8163728-8163750 ATGGAAAAGCACCATGGGCCTGG - Intergenic
927957917 2:27221080-27221102 ATGCAAAAGCACCAAAAGTTTGG + Intronic
927995888 2:27485711-27485733 ATGCAAATGCACTAAGAGGCAGG + Intronic
929756946 2:44774924-44774946 AGGGAAAATCAGCAAGGGGCGGG - Intergenic
930247623 2:49001369-49001391 AAGCAACATCACCAAGAGGCAGG - Intronic
930924707 2:56802992-56803014 ATGCAAGAGAACCAAGAGCCAGG - Intergenic
936055980 2:109262318-109262340 GTGGAAAAGCACCAGGAGGGTGG + Intronic
937027712 2:118712982-118713004 CTGGAAAAGGACCAAGAACCTGG + Intergenic
937756698 2:125547816-125547838 ATGGAAAACCAACAAGAGCAAGG + Intergenic
937839660 2:126512592-126512614 ATGGAAACGCAGCACGAGGCAGG - Intergenic
942525231 2:176846016-176846038 ATGGGAAAGCACCAAAAGCCAGG + Intergenic
944686657 2:202123562-202123584 ATGCAGGAGCACCGAGAGGCAGG + Intronic
944729433 2:202502247-202502269 ATGCAAAAACACAAAGAGGTGGG + Intronic
944905369 2:204256723-204256745 ATGGAAAAGCATCAATCAGCTGG + Intergenic
945389579 2:209247659-209247681 ATAGAAAAGCAACAGGAGGCCGG + Intergenic
945819175 2:214642216-214642238 ATGGAAAAAAACCAAGTTGCAGG - Intergenic
947039152 2:225895493-225895515 ATTGGAAATCACCAGGAGGCAGG - Intergenic
1169169784 20:3455696-3455718 ATTGAAATACACCAATAGGCTGG + Intergenic
1170039888 20:12028751-12028773 ATTGAAAAGCACGAAGTGACAGG + Intergenic
1170290592 20:14764338-14764360 ATGTCAAATCACCAAGAGGACGG - Intronic
1170438876 20:16357891-16357913 ATCAAAAACCATCAAGAGGCTGG + Intronic
1170678629 20:18504968-18504990 GTGGAAAAGGACCAAGATGGGGG + Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1172761068 20:37322502-37322524 ATTGAAAAGAACAAAGAGCCTGG - Intergenic
1173039589 20:39449788-39449810 ATGGTAAAGCAGCTAGGGGCTGG + Intergenic
1173066067 20:39713275-39713297 ATGGCAAGGCAGAAAGAGGCAGG + Intergenic
1174753086 20:53131578-53131600 GTGGGAAAGCACCAACACGCAGG - Intronic
1175034996 20:55991741-55991763 ATGAAAAAGCAAGAAGCGGCTGG - Intergenic
1175141644 20:56865060-56865082 ATGGAAAAGCAGGGGGAGGCTGG + Intergenic
1176269891 20:64230823-64230845 AGGGAAAAGAACCAAGAGAGGGG + Intronic
1177030489 21:15977434-15977456 ATGCAAAAGCATAAAGAGGGAGG - Intergenic
1178354597 21:31900069-31900091 ATCAAAAAGCAGCCAGAGGCTGG - Intronic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1179893085 21:44347178-44347200 CGGGAACAGCACCAAGAGGATGG + Intergenic
1183066481 22:35366961-35366983 AAAGAATAGCACCATGAGGCCGG - Intergenic
1183704190 22:39466766-39466788 TGGGAAAAGCACTTAGAGGCCGG - Intronic
1183916609 22:41125560-41125582 ATGGCAAAAAACCAAGTGGCCGG - Intronic
949215479 3:1562140-1562162 ATGGAAAAGAACCATGGGGGTGG - Intergenic
950466084 3:13154405-13154427 ATGGAAACACACCAGGAAGCTGG + Intergenic
952505804 3:34005874-34005896 AAGCAAAAGCACATAGAGGCTGG + Intergenic
952741677 3:36739902-36739924 ATGAAACACCAACAAGAGGCAGG + Intergenic
952872395 3:37912348-37912370 TTTCAAAAGCAGCAAGAGGCTGG - Intronic
953617141 3:44501445-44501467 ATGGAAAAACACCAAAATGTGGG + Intronic
954259627 3:49429213-49429235 ATGGCAAGGCACCAAAACGCGGG + Exonic
955109854 3:55937568-55937590 ATGGAAAAGCACCTCCAGGGGGG + Intronic
955913286 3:63880456-63880478 ATGGAAAGGCACCAAAAGACTGG - Intronic
958557832 3:95703199-95703221 ACGGGATAGCACCAAGAGGATGG - Intergenic
959405234 3:105953415-105953437 ATAGAAAAACAACATGAGGCTGG - Intergenic
959558109 3:107746749-107746771 ATGGGAAAGAATCAGGAGGCTGG - Intronic
959720714 3:109484772-109484794 AAGGAAGAGAAGCAAGAGGCAGG - Intergenic
960146071 3:114204592-114204614 GTGGAAAAGCAGCTAGAGCCAGG + Intergenic
961054202 3:123774062-123774084 ATGGAAAAGCAAGGAGAGGCTGG + Intronic
962390974 3:134972727-134972749 ATGCACAGGGACCAAGAGGCAGG + Intronic
962432192 3:135329812-135329834 ATGGACAAGCACTCATAGGCAGG - Intergenic
962611715 3:137083015-137083037 ATGGAAAACCACCAACTGTCTGG - Intergenic
962690428 3:137891440-137891462 ATTCAAAAGAACCAAGAGCCAGG - Intergenic
963656401 3:148056934-148056956 ATGGGATAGCAGCAAGAGGAGGG - Intergenic
966229159 3:177631815-177631837 ATTAAAAAGCAACAACAGGCTGG - Intergenic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
970388054 4:15576558-15576580 AAGAAAAAGAAACAAGAGGCAGG - Intronic
970422098 4:15914890-15914912 ATGGGGAAGCACCAGGAGGCAGG + Intergenic
970522932 4:16903670-16903692 ACGGGCAAGCACAAAGAGGCTGG - Intergenic
972583512 4:40416055-40416077 ATGAAAGAGAAGCAAGAGGCCGG + Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976146887 4:82050907-82050929 ATGGAAAAGATCCAAGATGCAGG + Intergenic
978686532 4:111451646-111451668 ATGCAATCTCACCAAGAGGCTGG + Intergenic
979286382 4:118929891-118929913 AGGGAAAAGGACCAATAAGCAGG + Intronic
979675831 4:123409540-123409562 ATGGGAAAGTAACTAGAGGCAGG + Intergenic
980525166 4:133980859-133980881 ATTAAAAACCACCAAAAGGCCGG + Intergenic
980632821 4:135458612-135458634 ATAGAAATGCAGAAAGAGGCTGG - Intergenic
981400056 4:144303352-144303374 ATGGATAAGCAGCAATTGGCTGG - Intergenic
982074733 4:151727215-151727237 ATGGAAAAGCAATAAAGGGCCGG - Intronic
982178966 4:152732440-152732462 GAAGAAAAGCACCAAGGGGCTGG - Intronic
982283112 4:153706367-153706389 AGGAAAAAGCAACAAGATGCAGG - Intergenic
982489399 4:156010472-156010494 CTGGAAAAGCACCAAAATACGGG - Intergenic
983474218 4:168195143-168195165 ATCCCAAAGCACAAAGAGGCTGG + Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
986625326 5:9718489-9718511 ATAAAAGTGCACCAAGAGGCTGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987287321 5:16469620-16469642 CTGGAACAGCACCAAGGGGATGG - Intergenic
987446274 5:18023284-18023306 ATAGAAAAACAAAAAGAGGCCGG - Intergenic
988435963 5:31175900-31175922 GTGGGAAAGCACCAAGAAGAGGG - Intergenic
990204484 5:53414160-53414182 GTGGAAAAGGACCAAGATGGGGG + Intergenic
991087125 5:62657925-62657947 ATGGAAAAACAAAAAAAGGCAGG + Intergenic
993397206 5:87405163-87405185 GTGGAAAAGGACCAAGAGAAGGG - Intronic
993793922 5:92242863-92242885 ATTTAAAACCACCAAGAGGTGGG + Intergenic
995149010 5:108820481-108820503 ATTGAGGAGCACCAAGAAGCTGG + Intronic
996389531 5:122944635-122944657 ATGGTAAAGCAGCAAGAGCCTGG - Intronic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
997628077 5:135344932-135344954 ATGGGAAAGGACCCACAGGCTGG + Intronic
998209580 5:140184224-140184246 ATGAAAAAGCACCAACATGGTGG - Intronic
998353094 5:141513725-141513747 GTGGAAAAGCACCGACAGGAAGG - Intergenic
1000701287 5:164453744-164453766 AAGGAAATGCACCATCAGGCAGG + Intergenic
1001136747 5:169108773-169108795 ATGGAGAAGCTCCAAGAGGGTGG + Intronic
1001419426 5:171575100-171575122 ATGGAAGTGCACAAAGAGTCAGG - Intergenic
1001661190 5:173394803-173394825 AGGGGAAAGCCCCAATAGGCAGG - Intergenic
1002743065 5:181447940-181447962 AGGGAAAATCACCATCAGGCTGG + Intergenic
1002954264 6:1846534-1846556 ATGGGAAAACTCTAAGAGGCTGG + Intronic
1003896382 6:10611707-10611729 ATGGAAAATTACCAAATGGCAGG - Intronic
1004272814 6:14210815-14210837 ATGGATAAGCAACAAGTGGCTGG + Intergenic
1004782598 6:18927858-18927880 ATGGTAAAGCAGCAAGAGAAAGG - Intergenic
1006096762 6:31660975-31660997 GTGGAAAAGAACCCAGGGGCAGG - Intergenic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1008376945 6:50802555-50802577 ATAAAAAAGCAGCAATAGGCTGG - Intergenic
1010351540 6:74880911-74880933 TTGGATAAACACCAGGAGGCTGG + Intergenic
1010495930 6:76533483-76533505 ACGGAAAAGCAGCCAGAGGCAGG - Intergenic
1011167551 6:84466215-84466237 ATGGCAAAGCAAAAAGAGCCAGG - Intergenic
1011255863 6:85420183-85420205 ATGCAATAGCATCAAGAGGTGGG - Intergenic
1011288828 6:85753953-85753975 ATGGAAAACCAAAAAAAGGCAGG + Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1012845312 6:104381045-104381067 AAGGGAAAGCAGCAAGAGTCTGG + Intergenic
1013956838 6:115852183-115852205 ATGGAGAAGCACAAAAAGTCAGG + Intergenic
1014648522 6:124006229-124006251 AAGGAAAAGCAACAAGAGCAAGG + Intronic
1015926970 6:138320428-138320450 ATGGAGAGGGACCTAGAGGCAGG + Intronic
1016031004 6:139338108-139338130 ATGGAGAAGAACAAAAAGGCAGG + Intergenic
1017574125 6:155782572-155782594 ATGGAAAATTACTAAGAGGAAGG - Intergenic
1017922213 6:158882494-158882516 GTGTAAAAGCAGGAAGAGGCCGG + Intronic
1018169072 6:161129828-161129850 ATGGTAAAGCTGGAAGAGGCGGG + Intergenic
1018423876 6:163663059-163663081 ATGGAAAAGGAACAGGAGGGTGG + Intergenic
1019006845 6:168805292-168805314 ATGGGAGAGGACCTAGAGGCAGG + Intergenic
1019248164 6:170723353-170723375 AGGGAAAATCACCATCAGGCTGG + Intergenic
1025634763 7:63312818-63312840 AGAGAAAGGCCCCAAGAGGCTGG + Intergenic
1025647932 7:63435352-63435374 AGAGAAAGGCCCCAAGAGGCTGG - Intergenic
1025843760 7:65176736-65176758 ATGGAAAAGCACAGGGAGGCCGG - Intergenic
1026538454 7:71259935-71259957 ATAAAACAGGACCAAGAGGCTGG - Intronic
1027290485 7:76703966-76703988 ATAGGTAACCACCAAGAGGCAGG + Intergenic
1029171441 7:98631852-98631874 ATGTCAAAGCCCCCAGAGGCTGG - Intergenic
1029795382 7:102889097-102889119 ATGGGAAAGAATCAAGAAGCAGG + Intronic
1030562192 7:111102712-111102734 ATAGAATAGCACGAAGAAGCTGG - Intronic
1035499936 8:84360-84382 AGGGAAAATCACCATCAGGCTGG - Intergenic
1035549992 8:514846-514868 AAGGAATGGCACCAACAGGCAGG + Intronic
1035598064 8:877152-877174 ATGAAAAAACAATAAGAGGCAGG - Intergenic
1036588258 8:10144999-10145021 AAGGAAAAGCAGGGAGAGGCGGG - Intronic
1037141509 8:15525885-15525907 TAGGAAAAGAAACAAGAGGCAGG + Intronic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1038175860 8:25181918-25181940 ATGAAAAAGAACCAAGAGGAGGG - Intergenic
1041646054 8:60253728-60253750 ATGGGAAAGTAGCATGAGGCAGG - Intronic
1041753653 8:61288754-61288776 ATGGAGAATCACCAGGAAGCAGG + Intronic
1042409145 8:68442230-68442252 ATGGAAAGTCACCAAGAGAAAGG + Intronic
1044692106 8:94891361-94891383 ATGAAAAACCACAAAGTGGCCGG + Intronic
1045376896 8:101583268-101583290 ATGGAAAACCAGCAATAGCCAGG + Intronic
1046477770 8:114770044-114770066 ATGTAAAAGTACCAAGAGGCAGG + Intergenic
1047145603 8:122195559-122195581 TTTGAAAAGCACTAACAGGCCGG - Intergenic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1047248620 8:123165489-123165511 ATGGAAGTGCAGGAAGAGGCCGG - Intergenic
1048766854 8:137854181-137854203 ATGCGAAAGTACCAAGATGCTGG + Intergenic
1050574035 9:6974016-6974038 ATTGAAAAACCCAAAGAGGCTGG + Intronic
1051222093 9:14859627-14859649 AGGGAAAAGAACAGAGAGGCTGG - Intronic
1052048587 9:23821874-23821896 TTGGAAGAGCGCCAGGAGGCGGG + Intronic
1053202512 9:36162381-36162403 ATGGAAGAACACCAAGAAGATGG + Exonic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055443723 9:76362248-76362270 CTGGAAACACACCAAAAGGCTGG + Exonic
1056833196 9:89933106-89933128 ATGCAAGGGCACCAAGAGACGGG + Intergenic
1056860988 9:90181659-90181681 ATGCAAAACCACCAACAGGGAGG + Intergenic
1057607552 9:96511274-96511296 CTAAAAAAGCAACAAGAGGCTGG + Intronic
1058731485 9:107854190-107854212 AGGGGAAAGCACCAAGATGATGG - Intergenic
1059110402 9:111553906-111553928 ATGGGAAAGCAACAAAATGCTGG - Intronic
1059745035 9:117191933-117191955 ATGGAAAAGGATCATGAGGGAGG + Intronic
1059911012 9:119044295-119044317 ATGCAAAAGCCCCAAGAGATGGG - Intergenic
1060688006 9:125630006-125630028 ATGGAAGTGCACTGAGAGGCAGG + Intronic
1061172167 9:128965056-128965078 AAGGACAAGCTCCAAAAGGCAGG - Intronic
1061456146 9:130699414-130699436 ACAGAAAAGCATCAAGAGGCTGG - Intronic
1061744004 9:132726562-132726584 AGGAAAAAGGAACAAGAGGCCGG - Intronic
1203608948 Un_KI270748v1:78975-78997 AGGGAAAATCACCATCAGGCTGG + Intergenic
1186807006 X:13149987-13150009 ATGGAAAAGCTCTCAGAAGCTGG - Intergenic
1188443456 X:30233863-30233885 CTGGAAAGGCACCCAGAGGGAGG + Intronic
1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG + Intergenic
1189957204 X:46288042-46288064 AAGCAAAAATACCAAGAGGCCGG - Intergenic
1190070381 X:47274364-47274386 ATGGCAAGGCACCAAAACGCGGG + Intergenic
1190925387 X:54899092-54899114 ATGGGCAAGAACCAACAGGCTGG + Intergenic
1191615318 X:63163875-63163897 ATTTAAAAGCTTCAAGAGGCCGG + Intergenic
1191620980 X:63215048-63215070 ATTTAAAAGCTTCAAGAGGCCGG - Intergenic
1191724350 X:64263328-64263350 TTTAAAAAGCACCAAGAGACAGG + Intergenic
1192869868 X:75175128-75175150 ATGCAAAAACACAAAGAGGTAGG - Intergenic
1194369789 X:93058625-93058647 AAAGAAAAGCAGCAAGAGTCTGG + Intergenic
1195663282 X:107403527-107403549 GAGGAAAGGCTCCAAGAGGCAGG - Intergenic
1196295649 X:113993898-113993920 ATGGAAAAGAACGAAAAGGAGGG - Intergenic
1197171944 X:123444367-123444389 AAGGAAAAGAACCAGGAGCCAGG + Intronic
1197998383 X:132405585-132405607 ATTTAAAAGCAACAACAGGCCGG + Intronic
1198391806 X:136182798-136182820 ATGTATAAGAACAAAGAGGCTGG + Intronic
1199907737 X:152251565-152251587 ATGGAAGAGAAGCAAGAGGAAGG - Intronic
1200323382 X:155213072-155213094 AGGAAATAGCCCCAAGAGGCTGG + Intronic
1200677978 Y:6174835-6174857 AAAGAAAAGCAGCAAGAGTCTGG + Intergenic
1201690995 Y:16764356-16764378 ATGGAAAACAACAAAAAGGCAGG + Intergenic
1201796006 Y:17896950-17896972 ATGGAAAACAAAAAAGAGGCAGG + Intergenic
1201805549 Y:18009035-18009057 ATGGAAAACAAAAAAGAGGCAGG - Intergenic