ID: 1088304443

View in Genome Browser
Species Human (GRCh38)
Location 11:108393174-108393196
Sequence TTGCTATTCTTGGGGAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088304443 Original CRISPR TTGCTATTCTTGGGGAACAA GGG (reversed) Intronic
900704260 1:4069287-4069309 TTGCTTTTTCTGGGGAATAAAGG - Intergenic
901217329 1:7562078-7562100 TGGCTTTTCCTGGGGCACAAAGG - Intronic
903421928 1:23224116-23224138 TAGCAATTTTTAGGGAACAAGGG - Intergenic
905573741 1:39026760-39026782 TGGCTATGTTTGGGGGACAATGG - Intronic
905588542 1:39142047-39142069 TTGCTTTTTGTGGGGAACAGTGG + Intronic
906061786 1:42953650-42953672 TTGCCAGTCTTGGGGAAGCAGGG + Intronic
908794807 1:67820445-67820467 TTGCTATTTTTTGTGGACAAAGG - Intronic
909889435 1:80985288-80985310 GTGCTGTGCTTGGGAAACAAAGG - Intergenic
910743012 1:90542255-90542277 TTGCTAGATTTGGGGAATAATGG - Intergenic
912073362 1:105841206-105841228 TTGCTCTTCTGGTTGAACAATGG + Intergenic
915162159 1:153928319-153928341 TTGTTATTGTTTGTGAACAAAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918086040 1:181246279-181246301 TAGCGATTTTTAGGGAACAAGGG + Intergenic
918176028 1:182045951-182045973 TAGCGATTTTTAGGGAACAAGGG - Intergenic
918453262 1:184681277-184681299 TAGCGATTTTTAGGGAACAAGGG - Intergenic
920699923 1:208210157-208210179 TTTATTTTCTTGGGGAACAAAGG - Intronic
923167073 1:231375873-231375895 TTGTTATTCATGGGAAAGAAGGG + Intronic
923751945 1:236754494-236754516 TGGCTGTTCTTGGTGATCAAAGG - Intronic
924355223 1:243166224-243166246 TTGGTATCCTGGGGGAATAAGGG - Intronic
924466357 1:244302225-244302247 TGGCTATTCTAGTGGAACCAGGG + Intergenic
924820008 1:247479959-247479981 TTGTTCTTGTTGGGGAGCAACGG + Intergenic
1063338812 10:5243872-5243894 TTGCACTTCTTGGGAGACAAAGG + Intergenic
1067485431 10:46645258-46645280 TTGTTATTCATGAGGACCAATGG - Intergenic
1067609329 10:47696406-47696428 TTGTTATTCATGAGGACCAATGG + Intergenic
1067767158 10:49095490-49095512 TTGCAATTGTTGGGGGACAGGGG - Intronic
1070840829 10:79486869-79486891 TTGCTTCTCTTTGAGAACAAAGG + Intergenic
1071624918 10:87158051-87158073 TTGTTATTCATGAGGACCAATGG + Exonic
1073354736 10:102844841-102844863 TAGCGATTTTTAGGGAACAAGGG - Intergenic
1075462879 10:122630556-122630578 TTGATTTCCTTGGGGAACCATGG - Intronic
1076446906 10:130521024-130521046 TAGCTAAACTAGGGGAACAAGGG - Intergenic
1077966167 11:7135937-7135959 TTGATAGTCTTGGGGAATGAAGG - Intergenic
1079561405 11:21825476-21825498 TTGCTCTTTTTAGGGAACCAAGG - Intergenic
1081151956 11:39643958-39643980 TTGCAAATCTTGTGGAACAATGG - Intergenic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1084322152 11:68379314-68379336 TTGCTGTTCTTGTGGAGCCATGG + Intronic
1086944890 11:92835200-92835222 CTCCTATTCTTGGGGACAAATGG - Intronic
1087493017 11:98851896-98851918 TGGCTAGCCTTGGGAAACAATGG - Intergenic
1088304443 11:108393174-108393196 TTGCTATTCTTGGGGAACAAGGG - Intronic
1088372888 11:109110803-109110825 TTGCTATTTTTGGGGTACTGAGG - Intergenic
1088427642 11:109722449-109722471 TTGAGATTCTTAGGGGACAACGG - Intergenic
1088505669 11:110524881-110524903 TTCGAATTCTTGGGGAACATTGG - Intergenic
1088790616 11:113223079-113223101 TTCATATTTTTGGGGAAAAAAGG + Intronic
1088838785 11:113604447-113604469 TTTCTTTTCTTGGAGAACAAAGG - Intergenic
1090548989 11:127797997-127798019 TTGCTATTCTGTGGGAGCACAGG + Intergenic
1090734272 11:129597742-129597764 ATGCTATTCCAGGGAAACAATGG - Intergenic
1091410431 12:235663-235685 TAGCGATTTTTAGGGAACAAGGG + Intronic
1092811682 12:12276601-12276623 TTGATATACTTGCGGAATAAAGG + Intergenic
1092900084 12:13050554-13050576 TGGCTATATTTGTGGAACAAGGG + Intronic
1093064402 12:14641382-14641404 TTGCTAATCCTGGTGATCAAAGG + Intronic
1093393841 12:18656121-18656143 TTGCTGTTTTTGTGGAAGAATGG - Intergenic
1095807850 12:46340292-46340314 TTGCTATTCTTGTGGGATTAAGG + Intergenic
1098013154 12:66075879-66075901 TTGGTAGGGTTGGGGAACAAAGG + Intergenic
1099306406 12:80961776-80961798 AGGCTAGTCTTGGGGAAGAATGG + Intronic
1101185724 12:102276555-102276577 TTGCTTTGCTTGGAGAAGAAGGG - Intergenic
1101844927 12:108355709-108355731 TTGAGATTCCTGGGGAACAAGGG - Intergenic
1105615087 13:22004641-22004663 TTGTTATATTTAGGGAACAATGG + Intergenic
1105650243 13:22369533-22369555 TGGCTAGCCTTGGGGAAGAATGG + Intergenic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1108953687 13:56122838-56122860 TTGCTATTCTTAGAGACCAAAGG + Intergenic
1110334160 13:74307325-74307347 TAGCTATTCTTGGAGACCAGAGG - Intergenic
1110646376 13:77890238-77890260 TTGCTATTCTTGAGAGACAGAGG - Intergenic
1113317803 13:109202389-109202411 TGGCTATTCTTGTGGGAGAAAGG + Intronic
1115522670 14:34248529-34248551 TTTCTATTATTGTGGAAGAAAGG + Intronic
1116934276 14:50722398-50722420 TTAATATTCTGGGGGAAAAAAGG - Intronic
1117083645 14:52177582-52177604 TTGTATTTCTTGGGGAACAGGGG - Intergenic
1118278170 14:64404662-64404684 TTGACATTCTTGATGAACAAGGG - Intronic
1118924764 14:70182094-70182116 AAGCAATACTTGGGGAACAAGGG + Intronic
1120726913 14:87954016-87954038 TTGTTATTCATGAGGACCAATGG + Intronic
1122477475 14:102020897-102020919 TTGGCATTCTTGGGCAACACCGG + Intronic
1125036059 15:35125070-35125092 TTACTATTTTTGGTGAATAAAGG - Intergenic
1127051024 15:55084394-55084416 TTGCTATGCTGAGGGCACAAAGG + Intergenic
1128906529 15:71472546-71472568 TTGCTCTTCTTAGAGAACAGAGG + Intronic
1130746085 15:86655274-86655296 CTTCAATTGTTGGGGAACAATGG - Intronic
1130842485 15:87714019-87714041 TTTCCATTCCTGGAGAACAATGG - Intergenic
1131896688 15:97040099-97040121 AGGCTATTCTTTGGGAAAAAAGG + Intergenic
1138758171 16:59514118-59514140 GTCCTATTCTGGGGGAAAAATGG - Intergenic
1139547400 16:67656137-67656159 TTGCTCTCCTTGGGGAGGAAGGG + Intronic
1140045902 16:71440651-71440673 TGGCTCTTCTAGGGGAGCAAAGG - Intergenic
1140059201 16:71553371-71553393 TTTCTAGCCTTGGGGAACATGGG - Intronic
1140490302 16:75329879-75329901 TTCCTGTTCTTGGGGAGCTATGG + Intronic
1143346807 17:6255609-6255631 TTTCTATTCTTGGGAACCCAGGG + Intergenic
1146441186 17:32896588-32896610 TTGCTTATCTTGGGAAACAAAGG + Intergenic
1146987451 17:37233872-37233894 TAGCTATTCTAGGGTAGCAAAGG + Intronic
1151306812 17:73267838-73267860 GTGGCATTCTTGGGGCACAAAGG - Intergenic
1151463491 17:74269737-74269759 TGGCTTTTCTTGGGAAATAAGGG - Intergenic
1155251843 18:23960389-23960411 TTGCCATTCTGAGGAAACAATGG + Intergenic
1155323502 18:24642875-24642897 CTGCGATTTTTAGGGAACAAGGG - Intergenic
1156197919 18:34796906-34796928 ATGCTATTCTTGGGGAGCTATGG - Intronic
1156212863 18:34965676-34965698 TGGATGTTCTTGGAGAACAAAGG + Intergenic
1163593245 19:18205745-18205767 TTTCTCTTCCTGGGGAAAAAAGG - Intergenic
1164188119 19:22889922-22889944 TGGCTATTGTTGGAGAAGAAAGG - Intergenic
1166781438 19:45345520-45345542 TTGCTGCTCCTGGGGAGCAATGG - Exonic
1167674571 19:50876458-50876480 TGGCTATTCCTGGGGAGGAAGGG - Exonic
1167950873 19:53026679-53026701 TTGCTTTTTGTGGAGAACAACGG - Intergenic
927387075 2:22547223-22547245 TTTCTATTCTAGGGGCTCAAAGG + Intergenic
927439600 2:23103805-23103827 TTGATTTTTTTGGAGAACAAAGG - Intergenic
928040682 2:27873307-27873329 CTGCTATTCTTGGGCAACTGTGG + Intronic
928739627 2:34335388-34335410 TTGCTAATATTTAGGAACAAGGG - Intergenic
931412856 2:62050488-62050510 TTGCTTTTGTTAGGGAAAAAGGG + Intronic
932319889 2:70814118-70814140 TTGGTATTCTTGGGACATAAAGG + Intronic
935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG + Intergenic
937112127 2:119374534-119374556 CAGCGATTTTTGGGGAACAAGGG - Intergenic
940051153 2:149466485-149466507 TTGCCATTCTGGGGGTAGAAGGG - Intronic
941135424 2:161711595-161711617 TTGGGATTCTGGGGAAACAAGGG - Intronic
943717468 2:191167925-191167947 TAGCGTTTCTTGGGGAACTAAGG + Intergenic
945155966 2:206838099-206838121 TTTCTATTTTTGGAGATCAATGG - Intergenic
945648836 2:212536473-212536495 TTGAAATTCTGGGGGCACAAAGG - Intronic
946192301 2:218013957-218013979 TTGCTTCTCTGGGGGAATAAGGG - Intergenic
1173328078 20:42051635-42051657 CTTCTAATTTTGGGGAACAAGGG + Intergenic
1176942851 21:14944658-14944680 TTGCTATGCTTGGGGAAGGGTGG + Intergenic
1177254898 21:18648957-18648979 TTGCTATTCTTGATGACCTAGGG - Intergenic
1178899725 21:36589232-36589254 GTGCTGTCCTTGGGGACCAAGGG - Intergenic
1182574760 22:31265811-31265833 ATGTTATTATTGGGGAACAGGGG - Intronic
1182578288 22:31288544-31288566 TTGCCATTCTTGGGCAAAATCGG - Intronic
1184107602 22:42377323-42377345 TTGCCATGCTTGGGAAACACGGG + Intergenic
1184606507 22:45577495-45577517 TTGTTATTCTTGGGGTGCAATGG + Intronic
949102606 3:164043-164065 TTGCTATTCCTGGAAAACAGTGG - Intergenic
949933963 3:9102152-9102174 TTTCTATTCTTAGGGATCACTGG + Intronic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
955378733 3:58419689-58419711 TGGCTAGCCTTGGGGAACAATGG + Intronic
955814369 3:62826415-62826437 ATGTTATTGTTGGGGAAAAATGG + Intronic
956304911 3:67813076-67813098 ATGCTACACATGGGGAACAATGG - Intergenic
957150222 3:76476820-76476842 TTTATATTCTTGGGAAAAAATGG + Intronic
962047705 3:131778083-131778105 ATGCTAATCTTGGAGGACAAGGG - Intronic
964023926 3:152048605-152048627 TTGCTCTATTTGGGGAACATAGG + Intergenic
967306541 3:188064970-188064992 TTGCAATTCTTGAAGTACAATGG + Intergenic
967371969 3:188756763-188756785 TTTCTATTCTTGGGATACAGTGG - Intronic
968885762 4:3331023-3331045 TTTCTATTCCTGTGGAAGAAGGG + Intronic
969804475 4:9596176-9596198 CAGCGATTCTTAGGGAACAAGGG - Intergenic
970406520 4:15769344-15769366 TTGGTATTTCTGGTGAACAAAGG + Intergenic
970550952 4:17180614-17180636 TTGCTAATCTTGGGGAGAAGAGG + Intergenic
970825618 4:20269853-20269875 TGGCTATTCTTGGGGGTGAAGGG - Intronic
971434616 4:26606947-26606969 TTTCTAATCTTGATGAACAAAGG - Intronic
971465082 4:26948834-26948856 TTGGGATTATTGGGTAACAAAGG + Intronic
971579808 4:28321783-28321805 TTGCTAGCCTTGGGGGAGAATGG + Intergenic
971752816 4:30673117-30673139 TTGCTATTCTTTAGGAAAATTGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
973572938 4:52258668-52258690 TTGCTATTGTTGGGCAAATATGG + Intergenic
974172085 4:58280149-58280171 TTGAAATTCTTGTGGATCAAGGG + Intergenic
974726539 4:65806273-65806295 TGGCTACTCTTGGGGTAGAATGG + Intergenic
975351231 4:73349703-73349725 TTGCTATTCTAGGGGAAAAGAGG + Intergenic
975820848 4:78268800-78268822 TGGCTATTCTTAGGGAATATGGG + Intronic
975992111 4:80267960-80267982 TAACTGTTCTTGGGGACCAAAGG - Intronic
976610969 4:87029946-87029968 TTGCTAATCTTTTGGAATAAGGG + Intronic
976925384 4:90489458-90489480 TTGCTAATCTTGGGCAAAGAGGG + Intronic
977170831 4:93760255-93760277 TTGCTATTCTTTTGGAAAATAGG + Intronic
977302457 4:95282943-95282965 TGGCTGGTCTTGGGGAAGAATGG + Intronic
978312498 4:107400028-107400050 TTGCGATTCTTGGGAAACTTGGG + Intergenic
978966661 4:114749519-114749541 GAGCTCTTCTTGGGGAAGAATGG - Intergenic
978995753 4:115149991-115150013 TTGCTATTCTTATGGAAGACTGG - Intergenic
982096081 4:151924724-151924746 TAGCTTTTCTTGGGGACCACTGG - Intergenic
982601744 4:157459920-157459942 TTGCTATTTTAGGCAAACAAGGG + Intergenic
984047929 4:174825120-174825142 TTGCTATTTTCAGGGAAAAAGGG + Intronic
985849278 5:2376706-2376728 TGGCTGTTCTTGGGCACCAAGGG - Intergenic
986992193 5:13567523-13567545 CTGCTATTCTTGCTAAACAATGG + Intergenic
987903579 5:24047386-24047408 TTGGTTTTCTTGAGCAACAAAGG - Intronic
994095186 5:95841528-95841550 TTGCTAATATTGGGGAACTTTGG + Intergenic
994224930 5:97240688-97240710 TTACTATGCCTGGAGAACAAGGG + Intergenic
995321987 5:110845187-110845209 TTGGGAATCTTGGGCAACAAGGG - Intergenic
995695486 5:114874435-114874457 TTCCTATTTTTGGGAAATAAAGG + Intergenic
998769460 5:145525361-145525383 GTCCCATTCTTGGAGAACAAGGG - Intronic
1000554507 5:162708554-162708576 TTACTATTCTTAGGAAACTATGG - Intergenic
1000689923 5:164304859-164304881 TTGCTCTTTTTTGGGAAGAAAGG + Intergenic
1001957325 5:175856928-175856950 TTGCCATTTTTGGAGAACCAAGG - Intronic
1002008366 5:176254890-176254912 TTGGTATACTTTGTGAACAAAGG - Intronic
1002218354 5:177657381-177657403 TTGGTATACTTTGTGAACAAAGG + Intergenic
1005143181 6:22657746-22657768 CTGCCATCCTTGGGCAACAAAGG + Intergenic
1005767511 6:29027604-29027626 TAGCTTTTCTTAAGGAACAATGG - Intergenic
1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG + Intergenic
1008203430 6:48621993-48622015 TTGCTATTCTGTGGGGAAAAAGG - Intergenic
1010776437 6:79891455-79891477 CAGCTATTTTTAGGGAACAAGGG - Intergenic
1011314698 6:86018493-86018515 TAGCAATTTTTAGGGAACAAGGG + Intergenic
1012537025 6:100311510-100311532 TTGCTAAGCTTGGGGTAAAATGG - Intergenic
1012801827 6:103840045-103840067 TTGTTATTTTTGGGGGACCAGGG - Intergenic
1014783315 6:125589302-125589324 CTTCCATTCTTTGGGAACAATGG + Intergenic
1018874822 6:167812531-167812553 TGGCTTTTCTTGGGGGACGATGG - Intergenic
1022205735 7:28161781-28161803 GTGAGATTCTTGGGGAATAAAGG - Intronic
1022839761 7:34152278-34152300 TTCCTATTCTTGAGGAATGAGGG + Intronic
1025108509 7:56193131-56193153 TTGCTATTTTTGGTTATCAATGG + Intergenic
1027497570 7:78907203-78907225 TAGCTCTTCTTTTGGAACAAAGG - Intronic
1028015099 7:85699588-85699610 TTGCTACTCTGAGGAAACAAAGG - Intergenic
1031241748 7:119252995-119253017 TTGATAGTCTTGGGGTAAAATGG + Intergenic
1031347161 7:120682536-120682558 ATACTATTCTTGGAGAACACTGG - Intronic
1031648568 7:124257579-124257601 TTGATATGATTGTGGAACAATGG - Intergenic
1034213811 7:149387776-149387798 TTGCTATCCTTAGGGAGAAAAGG - Intergenic
1035132215 7:156666027-156666049 TTGCTATACTTGGGAACCATTGG + Intronic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1039040469 8:33403196-33403218 TTGCTTTTCTTTGGGAATACGGG - Intronic
1039333228 8:36561923-36561945 TTGCTAGTCTTGGGGGAGAATGG - Intergenic
1041101038 8:54396653-54396675 TTGTTATTCTCGGGGAACACGGG + Intergenic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1047371537 8:124260082-124260104 TTTCTATGTTTGGGGAAAAAGGG + Intergenic
1047595731 8:126375925-126375947 TTGCTACTCTTGGGGGGCAATGG - Intergenic
1048510731 8:135059917-135059939 TTGCTTTGCTTTGGAAACAAGGG - Intergenic
1050719165 9:8565302-8565324 TTACTATTCTAGGGAAAAAAAGG - Intronic
1053422613 9:37989210-37989232 TTTCTCTTCTTAGGAAACAAAGG + Intronic
1053608644 9:39687001-39687023 TTCCTCTTCCTGGGGAATAAGGG - Intergenic
1053866493 9:42443359-42443381 TTCCTCTTCCTGGGGAATAAGGG - Intergenic
1054244881 9:62655409-62655431 TTCCTCTTCCTGGGGAATAAGGG + Intergenic
1054559006 9:66689940-66689962 TTCCTCTTCCTGGGGAATAAGGG + Intergenic
1055871306 9:80883813-80883835 TGGGTATTCTTGGGGCAAAAAGG + Intergenic
1056693679 9:88828520-88828542 TTTCTTTCCCTGGGGAACAATGG - Intergenic
1058242859 9:102587995-102588017 TTTCTATTCTTGGTTAATAAAGG + Intergenic
1060284659 9:122238562-122238584 TTGCTATTCTTTGAATACAAGGG - Exonic
1060498953 9:124138377-124138399 TGGCTAGCCTTGGGGGACAATGG + Intergenic
1061974070 9:134059597-134059619 CTCCTTTTCTTGGGGAACAGGGG + Intronic
1186336691 X:8597234-8597256 TAGCTCTTCTTGGGGAAGAGAGG + Exonic
1187775106 X:22747637-22747659 ATGCTATGCTAGGGGAAAAAGGG + Intergenic
1188145674 X:26609382-26609404 TTGCTTTACTTGGGGAGTAAGGG - Intergenic
1188159820 X:26785303-26785325 TTCCTATTCTTGGTGGACTATGG + Intergenic
1192172040 X:68861815-68861837 TTGCTATGTTTTGGGAACATAGG - Intergenic
1192982569 X:76361866-76361888 TTGCATTTCTTTGGGATCAATGG + Intergenic
1197568541 X:128119415-128119437 TTGCTAGTCTAAGGAAACAAAGG - Intergenic