ID: 1088305074

View in Genome Browser
Species Human (GRCh38)
Location 11:108399123-108399145
Sequence GCACCTCAGTGGTTGCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088305074_1088305081 2 Left 1088305074 11:108399123-108399145 CCACGGTGCAACCACTGAGGTGC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1088305081 11:108399148-108399170 GGGGAAAAAATGACATTCACAGG 0: 1
1: 1
2: 1
3: 32
4: 327
1088305074_1088305082 6 Left 1088305074 11:108399123-108399145 CCACGGTGCAACCACTGAGGTGC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1088305082 11:108399152-108399174 AAAAAATGACATTCACAGGATGG 0: 1
1: 1
2: 4
3: 62
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088305074 Original CRISPR GCACCTCAGTGGTTGCACCG TGG (reversed) Intronic
900225880 1:1533471-1533493 GCACATGAGTGGTGGCACCAAGG - Intronic
908704069 1:66930998-66931020 GCAGCTCAGAGGTTGTACCTTGG - Intronic
915934668 1:160083606-160083628 GCACCTCAGGGGCAGCCCCGGGG - Intronic
919766007 1:201127721-201127743 GCACTCCAGGGGTTGAACCGGGG + Intergenic
921340203 1:214126959-214126981 GAACCTCAGTGTTTGCTCTGGGG - Intergenic
1064300258 10:14117025-14117047 GCATCTCTGTGCTTGCACTGAGG + Intronic
1065974224 10:30828519-30828541 GCACCATCGAGGTTGCACCGTGG - Intronic
1066037573 10:31508731-31508753 GGACATCAGTGGTTGCACTGTGG + Intronic
1069807402 10:71134497-71134519 GAACCTCAGTGGCAGCACCATGG - Intergenic
1074704030 10:116115670-116115692 GCACCCCATTTGTTGCTCCGTGG + Intronic
1085385763 11:76157342-76157364 GCACCTCAGTGGCTGGGCGGGGG - Intergenic
1088305074 11:108399123-108399145 GCACCTCAGTGGTTGCACCGTGG - Intronic
1091312389 11:134584025-134584047 GCCACTGAGTGGTTGCATCGGGG - Intergenic
1092940660 12:13404338-13404360 GCACCTCAGTGGCCACACCATGG + Intergenic
1093229280 12:16523489-16523511 GTACATCAGTGATTGCACTGTGG - Intronic
1094633973 12:32205873-32205895 GCAGATGAGTGGTTGCACTGGGG - Intronic
1104578470 12:129990464-129990486 GCACCTCAGTGGTAGTCCAGGGG - Intergenic
1104879980 12:132064004-132064026 GGTCATCAGTGGTTGAACCGGGG - Intronic
1104880000 12:132064066-132064088 GGTCATCAGTGGTTGAACCGGGG - Intronic
1104880016 12:132064125-132064147 GTGTCTCAGTGGTTGAACCGGGG - Intronic
1112573160 13:100612041-100612063 GCACCTCCGGGGATGCACTGTGG + Intronic
1114101157 14:19383634-19383656 GCAGCACAGTTGTTGCACTGAGG + Intergenic
1115459622 14:33645820-33645842 GCACCTCTGTGGTTTCATCTAGG + Intronic
1115535586 14:34369943-34369965 TCACCACAGTGCTTGCACTGAGG + Intronic
1116018450 14:39432965-39432987 CCACCTGCGTGGTTGGACCGAGG - Intergenic
1117564296 14:56977652-56977674 GCACCTCTGTTCTTGCAACGTGG + Intergenic
1119535092 14:75396417-75396439 GCACATCAGTGATTGCCCCCAGG + Intergenic
1121485628 14:94312417-94312439 GCTCAGCAGTGGTTGCACAGAGG - Intronic
1122002512 14:98671934-98671956 GCAGATCAGTGGTTGCCCAGGGG - Intergenic
1122352392 14:101103633-101103655 CCCACTCAGGGGTTGCACCGCGG + Intergenic
1123008629 14:105336439-105336461 GCCCAGCAGTGGTGGCACCGTGG + Intronic
1124360448 15:29033065-29033087 GCCCCTCTGAGGTTGCACTGTGG + Intronic
1124555011 15:30717383-30717405 GCACATCAGTGGGCACACCGTGG + Intronic
1124676237 15:31688296-31688318 GCACATCAGTGGGCACACCGTGG - Intronic
1128359695 15:66953321-66953343 GCACCTGAGTGATTGCACGGGGG + Intergenic
1132745921 16:1436268-1436290 GCGCCTCAGAGGCTGCACCAGGG + Intronic
1133863721 16:9621557-9621579 GCACCTCAGTGGTCCCATCCAGG + Intergenic
1137566405 16:49535246-49535268 GCACCTCAGTGCTAGCTCCCTGG - Intronic
1142509158 17:383902-383924 TCACCTCCCTGGCTGCACCGGGG - Intronic
1142509171 17:383943-383965 TCACCTCCCTGGCTGCACCGGGG - Intronic
1144672878 17:17142787-17142809 GCACCTCAGGGGTGGCTCGGGGG + Intronic
1162248484 19:9423063-9423085 GCACCTCAGTGCTTGCTCAATGG + Intronic
1166859401 19:45801146-45801168 GAGCCTCAGTGGCTGCACCCAGG + Intronic
925001436 2:405983-406005 GCATTTCAGTGGTTCCACAGTGG + Intergenic
929787201 2:45001436-45001458 GCACCTAAGTGAATGCGCCGGGG - Intergenic
934494694 2:94787374-94787396 GCAGCACAGTTGTTGCACTGAGG + Intergenic
944692478 2:202170396-202170418 CTATCTCAGTGGTAGCACCGTGG - Intronic
1173551865 20:43938108-43938130 GCACCCCAGTGACTGCACGGTGG + Intronic
1175020771 20:55846539-55846561 GGACATCAGTGGTAGTACCGAGG + Intergenic
1180479582 22:15738957-15738979 GCAGCACAGTTGTTGCACTGAGG - Intergenic
950307237 3:11925404-11925426 GTACCTCAGTGGTTTCATCTTGG - Intergenic
950696237 3:14703267-14703289 GCACCTCAGTGCTTGGGTCGGGG + Intronic
952036774 3:29212427-29212449 TCACCTCAGTGCTTGGACCTGGG - Intergenic
952920545 3:38281099-38281121 TCACCTCAGTGGTTGGTCCTAGG - Intergenic
956748993 3:72331589-72331611 GAACCTCTGAGGTTGCAGCGGGG - Intergenic
956900483 3:73710570-73710592 GCACCTCAGAGATTGAACTGTGG + Intergenic
961402529 3:126657219-126657241 GCTCCTCAGTGGGTGCACCATGG + Intergenic
966736222 3:183189215-183189237 GCACCCCAGTGCCTGCACCATGG - Intronic
969198876 4:5585748-5585770 GCACATCAGTGGTTGCTAAGTGG - Intronic
971092526 4:23361585-23361607 GCACGCCAGTTGTTGCAGCGGGG - Intergenic
980321219 4:131279099-131279121 GCCTCTCAGAGGTTGCACTGGGG - Intergenic
997581717 5:135021526-135021548 GCACCTCAGTGGGAGGACAGGGG + Intergenic
999863412 5:155674028-155674050 CCAGCTCAGTGGTTGAACCAAGG - Intergenic
1002780055 6:358759-358781 GCACCTCAGTGATTGGATGGAGG + Intergenic
1004964405 6:20831641-20831663 GCAGCTCAGTGGTTGGACTGAGG - Intronic
1007118220 6:39359252-39359274 ACACCTCAGTTGTGGCACAGCGG - Intronic
1008620424 6:53266014-53266036 GCACACCAGTGGTTGCTCTGAGG - Intergenic
1009703280 6:67211591-67211613 ACACTTCAGTGTTTGCACAGTGG - Intergenic
1016125343 6:140395470-140395492 GCAACTAAGTAGTTGCACGGTGG - Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1034268894 7:149793856-149793878 GCACCTCAAAGGTGGCACCATGG - Intergenic
1034397158 7:150835911-150835933 GAACCTCAGTGGAGGCCCCGTGG - Intronic
1034549870 7:151813693-151813715 CCTCCTCAGTGGCTGAACCGTGG - Intronic
1037709588 8:21345169-21345191 GCACCTCTGTGCTTGCACGAGGG + Intergenic
1039209872 8:35201868-35201890 GCACCTCACAGGTTGCAGTGAGG - Intergenic
1040101964 8:43513500-43513522 GCAGCACAGTTGTTGCACTGAGG - Intergenic
1047334058 8:123919479-123919501 GCCCCTCAGTGCTTGCCCTGGGG + Intronic
1048038837 8:130705766-130705788 GCACCTCTGTGGTTGACCAGTGG - Intergenic
1048198552 8:132352560-132352582 GCACCACAGTGCTTGCAGGGAGG + Intronic
1048267897 8:133003853-133003875 GCAAGTCAGTGTTTGCACCCAGG - Intronic
1052877239 9:33576074-33576096 GCAGCACAGTGGTTGCATTGAGG - Intergenic
1053498763 9:38568320-38568342 GCAGCACAGTGGTTGCATTGAGG + Intronic
1056467181 9:86869145-86869167 GCATGTCAGTGGTTGCTCTGGGG + Intergenic
1057587858 9:96345773-96345795 GCCCCTCACTGGCTGCACCCTGG - Intronic
1057678215 9:97152813-97152835 GCAGCACAGTTGTTGCACTGAGG + Intergenic
1057760749 9:97872429-97872451 GCACATCAGTGGTTAAACTGTGG + Intergenic
1060355531 9:122904585-122904607 GGACCTGAGTGGTTGCACAGGGG - Intronic
1188465286 X:30472716-30472738 GCACCTGATTGGTTGCGCCAAGG + Intergenic
1194149305 X:90303759-90303781 ACAATTCAGTGGTGGCACCGTGG - Intergenic
1196998793 X:121415600-121415622 GCACCCCAGTGGTGGCAGCTGGG + Intergenic
1197701187 X:129601157-129601179 GCACCTCGGAGGCAGCACCGTGG + Intergenic
1200495680 Y:3880489-3880511 ACAATTCAGTGGTGGCACCGTGG - Intergenic