ID: 1088307036

View in Genome Browser
Species Human (GRCh38)
Location 11:108421732-108421754
Sequence ATTCCTGGTGTGGCTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088307036_1088307047 21 Left 1088307036 11:108421732-108421754 CCCCAAAAAGCCACACCAGGAAT 0: 1
1: 0
2: 1
3: 18
4: 279
Right 1088307047 11:108421776-108421798 TGCTGCCAAGCTGGAGAACAAGG 0: 1
1: 0
2: 0
3: 33
4: 373
1088307036_1088307045 12 Left 1088307036 11:108421732-108421754 CCCCAAAAAGCCACACCAGGAAT 0: 1
1: 0
2: 1
3: 18
4: 279
Right 1088307045 11:108421767-108421789 TTCCACAGCTGCTGCCAAGCTGG 0: 1
1: 0
2: 0
3: 28
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088307036 Original CRISPR ATTCCTGGTGTGGCTTTTTG GGG (reversed) Intronic
900110827 1:1004877-1004899 ATTGCTGGTGTGGATTTTGAAGG - Intergenic
903534067 1:24054954-24054976 ATTCCTGGTCTGGCTGGGTGTGG - Intergenic
904126996 1:28248055-28248077 ATTCCAAGTGTGGCCTTTTTAGG + Intergenic
904708481 1:32410257-32410279 ATTTCAGATGTGGCTTTTGGGGG - Intergenic
906215601 1:44036396-44036418 ATTCCTGGTGAGGAATATTGAGG - Intergenic
908170837 1:61503125-61503147 CTTCCTGGTGTGGCCCTGTGTGG + Intergenic
909017159 1:70392603-70392625 ATTCACGGTGTGGCTGTTTGTGG - Intergenic
910001592 1:82349031-82349053 ATACCTGGAGTGGATTTGTGAGG + Intergenic
913333540 1:117686838-117686860 ATTCCTTGTTTTGCTTATTGAGG - Intergenic
916640203 1:166719889-166719911 ATTCACTGTGTGGATTTTTGGGG + Intergenic
916703481 1:167322450-167322472 ATTCCTGTTGGCACTTTTTGTGG + Intronic
916826287 1:168445064-168445086 CTTCCTGGGGTGGCTGTTGGTGG + Intergenic
917688533 1:177443620-177443642 ATGTCTGGTGTGTCTTTTAGGGG - Intergenic
918854198 1:189729728-189729750 ATTCCAGGTGGTGCTATTTGGGG - Intergenic
919190089 1:194205187-194205209 TTTCATTTTGTGGCTTTTTGGGG - Intergenic
920456583 1:206106338-206106360 ATAGCTCATGTGGCTTTTTGAGG + Intergenic
920664511 1:207952113-207952135 ATTCTGTGTGTAGCTTTTTGAGG + Intergenic
921521980 1:216167233-216167255 ATTTCTGGTGGGGCGTTGTGGGG - Intronic
921785128 1:219220666-219220688 ATTTCTGGAGTCGATTTTTGAGG + Intergenic
922204881 1:223437535-223437557 AATTCTGCTGTGGCTTTTTATGG - Intergenic
922433956 1:225584467-225584489 ATTCCTTTTCTGCCTTTTTGGGG - Intronic
922812438 1:228425007-228425029 TTACCTGGTGGGGCTGTTTGAGG - Exonic
923615957 1:235537652-235537674 ATTTTTGGTGTGGCTTTTGTGGG + Intergenic
924106106 1:240650686-240650708 ATTCCTCGTCTTGCTTTCTGAGG + Intergenic
924296731 1:242594792-242594814 ATTCATTATGTGGGTTTTTGGGG + Intergenic
924541988 1:244989821-244989843 ATTCATGGTTTGGCTTTCCGTGG + Intronic
1063342508 10:5280557-5280579 ATCTCTGGTGAAGCTTTTTGTGG - Intergenic
1064547680 10:16467103-16467125 ATCCATGGTTTTGCTTTTTGTGG + Intronic
1064683479 10:17835061-17835083 ATTCCCGGTCTTGCATTTTGCGG + Intronic
1064880670 10:20049559-20049581 ACTCTTGGTGTGGCTGTTGGTGG - Intronic
1066263698 10:33754100-33754122 ATTCATGGTTTTGCTTTCTGTGG + Intergenic
1070919685 10:80176744-80176766 ATTCTTGGGGTGGCTTTTAAGGG + Intronic
1072340853 10:94447588-94447610 ATTCCTAGTATTACTTTTTGAGG + Intronic
1073061966 10:100738547-100738569 ATTTCTGATGTGTCTCTTTGGGG - Intronic
1073165596 10:101446847-101446869 ATTCCTGGTTTAGATCTTTGGGG - Intronic
1074836369 10:117299844-117299866 ATTGCTGGTGTGATCTTTTGGGG + Intronic
1074946729 10:118287167-118287189 ATTACTGGTGTAGCTGTTTGAGG + Intergenic
1075261489 10:120967136-120967158 ATTCCTCCTGGAGCTTTTTGGGG + Intergenic
1076788284 10:132762412-132762434 TCTCCTGGTGTGTATTTTTGTGG - Intronic
1078434964 11:11316757-11316779 ATTCCTGCTCTCTCTTTTTGTGG + Intronic
1078488655 11:11748511-11748533 ATTCTTGGTATGGTTCTTTGTGG - Intergenic
1078960987 11:16270446-16270468 ATTCCATGTTTAGCTTTTTGAGG - Intronic
1080367284 11:31590296-31590318 AGTCCTGGTCTAGTTTTTTGTGG - Intronic
1086383463 11:86284148-86284170 ATCCCTGTTGTAGCCTTTTGTGG + Intergenic
1087368041 11:97247207-97247229 ATTCCTTATCTGGCATTTTGAGG + Intergenic
1088081695 11:105924507-105924529 ACTCCTGGTTTGGATTTCTGAGG - Exonic
1088307036 11:108421732-108421754 ATTCCTGGTGTGGCTTTTTGGGG - Intronic
1088334970 11:108693699-108693721 AGTGCTGGTTTGGCATTTTGTGG + Intronic
1089965782 11:122654306-122654328 ACCCATGGAGTGGCTTTTTGAGG - Intergenic
1090711582 11:129391151-129391173 ATCCCTGGTCTAGCTTTCTGTGG - Intronic
1092193569 12:6536165-6536187 ATTCCTGGGGTGGCATAGTGGGG + Intronic
1092321664 12:7482962-7482984 ATACCTGTTGTGGCTTTTTGTGG + Exonic
1093517428 12:20005164-20005186 GTTCCTCTTGTGGCTTTTGGTGG + Intergenic
1093726743 12:22521587-22521609 ATTGCAGGTTTAGCTTTTTGAGG - Intronic
1094004698 12:25737257-25737279 TTTCTTGGAGTGGCTTTTTATGG - Intergenic
1094471721 12:30807727-30807749 CTTCTTGGTGTGGCTTGTTTTGG - Intergenic
1095912921 12:47447306-47447328 ACTCCTGTTGGGGCCTTTTGCGG + Intergenic
1096493640 12:52026748-52026770 ATTCCCAGTGTGGCTTTAGGCGG - Intronic
1099958063 12:89370538-89370560 GTTCTTGCTGGGGCTTTTTGTGG - Intergenic
1102311257 12:111846226-111846248 ATTCATTGTTTTGCTTTTTGGGG + Intronic
1103010834 12:117457001-117457023 AATCTTGGTGTTGCTTTCTGAGG - Exonic
1105011457 12:132759763-132759785 ATACCTGGTTAGGCTTTTTTGGG - Intronic
1106106859 13:26740634-26740656 ACTCCAGTGGTGGCTTTTTGGGG - Intergenic
1106958171 13:34966558-34966580 AATCCTGGTCTGTCTTTTCGTGG + Intronic
1108365573 13:49708471-49708493 ATTCTGGGTTTAGCTTTTTGAGG - Intronic
1109261399 13:60149244-60149266 ATTCCTTGTGTGGATATTGGAGG + Intronic
1109730682 13:66409471-66409493 ATTCATGGTGAGGCTAATTGTGG - Intronic
1112209346 13:97359915-97359937 ATTCCTGGTATGGGTTTAAGCGG - Intronic
1112753588 13:102606382-102606404 AGTCCAGGCATGGCTTTTTGTGG + Intronic
1113400291 13:109986069-109986091 ATTCCTGGTGGGGATGCTTGTGG + Intergenic
1113763531 13:112866509-112866531 ATGCCTGGTGTGGCTCTCTCAGG - Intronic
1114639299 14:24208374-24208396 ATTCATGATGTGGCTCTTAGGGG + Intronic
1115936966 14:38562598-38562620 ATTCCTTATATGGCATTTTGAGG - Intergenic
1117023694 14:51598202-51598224 ATTTCTGGTTTGGTTTTTTGGGG - Intronic
1118882887 14:69843688-69843710 ACTCCTGTTGTGACTTTCTGAGG + Intergenic
1121268408 14:92620763-92620785 ATTCATTATGTGGGTTTTTGGGG - Intronic
1121289394 14:92761923-92761945 ATTCCTGTTGTGGCGTTTGAGGG - Intergenic
1121737242 14:96227004-96227026 CTTGCTGGAGTGGCTTTTAGGGG - Intronic
1122520034 14:102337041-102337063 CTTCCTTATGTGGGTTTTTGGGG + Intronic
1125021098 15:34987881-34987903 TTTCCTGGCGTGGGATTTTGTGG - Intronic
1125845644 15:42850465-42850487 ATTCTTGGAGTGGCTATTTGAGG - Intronic
1127215894 15:56822782-56822804 TTTTCTGGTTTGGCTTTTTGAGG + Intronic
1127667122 15:61158703-61158725 GTTCCTGGTCTGGATTGTTGCGG + Intronic
1127896681 15:63306422-63306444 ATTCCAGGTTTTGCTTTCTGAGG + Exonic
1128929207 15:71689188-71689210 ATCCTTGGTCTGACTTTTTGAGG - Intronic
1129259067 15:74353618-74353640 ATTCATTATGTGGGTTTTTGGGG + Intronic
1130019128 15:80212381-80212403 TTTCCTGTTGTGGCTTTCAGTGG - Intergenic
1130754275 15:86746028-86746050 GTTCCTGTTGGGGCTTCTTGTGG + Intronic
1130861518 15:87894985-87895007 ATTCCTGGTATATCTTTGTGGGG + Intronic
1131580381 15:93637010-93637032 ATTTCTGGTTTGGGTCTTTGAGG + Intergenic
1132730476 16:1358635-1358657 ATTCCATGTTTAGCTTTTTGAGG + Intronic
1133146367 16:3790007-3790029 TTTGGGGGTGTGGCTTTTTGAGG - Intronic
1133467018 16:6037213-6037235 ATTACTGTTGTGGTTTTATGGGG - Intronic
1134446097 16:14332661-14332683 ACTACTGGTGTGGCCTTCTGTGG + Intergenic
1135390086 16:22085221-22085243 CTTCCTTGTGTGGCCTTTTGAGG + Intronic
1135677661 16:24430740-24430762 CTTCCTGCTGTGTCTTCTTGTGG - Intergenic
1139791290 16:69438438-69438460 ATTCTATGTTTGGCTTTTTGAGG + Intronic
1140584338 16:76271211-76271233 TTTCCTGGTGTGTCTTTGTCTGG - Intergenic
1140832987 16:78768767-78768789 CTTGCTGGTGGGTCTTTTTGTGG + Intronic
1140857889 16:78993772-78993794 AGTCCGGGGGTGGCTTTTCGTGG + Intronic
1141832424 16:86517157-86517179 AGTCCTGGTGGAGCTTTTGGGGG + Intergenic
1147479257 17:40743651-40743673 ATTGCATGTATGGCTTTTTGGGG + Intergenic
1149809664 17:59655980-59656002 ATTCCAGCTGTGGCTTCATGAGG - Exonic
1149982345 17:61321378-61321400 ATTCATACTGTGGCTTCTTGGGG + Intronic
1154316869 18:13311242-13311264 AGTCCCTGTCTGGCTTTTTGAGG - Intronic
1155269736 18:24128283-24128305 ATTCCTAGCCTGGCTTTCTGGGG + Intronic
1156235395 18:35198714-35198736 ATGCCAGGGGTGGCTGTTTGGGG + Intergenic
1159054901 18:63453734-63453756 ATTCCTGGTGTGTGTGTTGGGGG + Intergenic
1162051058 19:8033375-8033397 ACTCCCGGTGGGGGTTTTTGGGG - Intronic
1162298405 19:9828877-9828899 ATCCTTTGTGTGACTTTTTGAGG + Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1165779139 19:38422137-38422159 ATTCCTGGTGGGACTTCCTGTGG + Exonic
1166401462 19:42483767-42483789 ATTTCCGGTGTGGATCTTTGTGG - Intergenic
925800731 2:7597923-7597945 ATGCCTGCTGTGGCTGTTTATGG + Intergenic
926992962 2:18699505-18699527 ATTCATGGTTTTACTTTTTGTGG + Intergenic
928064744 2:28152141-28152163 ATTTCAGATGTGGCTCTTTGGGG - Intronic
929065201 2:37966078-37966100 ATTCTTGGTGTGGATCTTTTTGG + Intronic
929102215 2:38326555-38326577 ATACCTAGTGTGGATTTTTTTGG - Intronic
930183373 2:48386520-48386542 ACTCCTGGTGGGACCTTTTGTGG - Intergenic
930284225 2:49408054-49408076 TTTCATGATGTGCCTTTTTGTGG + Intergenic
930324729 2:49900984-49901006 ATTTCTTGTGTCGCTATTTGTGG + Intergenic
930590994 2:53326223-53326245 ATTCCTGGTGTGTGTGTTGGGGG - Intergenic
931903804 2:66821063-66821085 ATTCCTGGTTAGGGTTATTGGGG + Intergenic
932548397 2:72740541-72740563 TTTCCTGGTGTGGCTGATTAAGG - Intronic
933483035 2:82881347-82881369 ATTTCTGGTCTAGATTTTTGAGG - Intergenic
933936445 2:87207713-87207735 ATTCCTGGTTTGGGGTTGTGAGG + Intergenic
934331345 2:92072947-92072969 CTTGGTGCTGTGGCTTTTTGCGG + Intergenic
936160084 2:110078339-110078361 GTGCCTGGTGTGGCTTTATTAGG - Intergenic
936184580 2:110293014-110293036 GTGCCTGGTGTGGCTTTATTAGG + Intergenic
936356704 2:111758116-111758138 ATTCCTGGTTTGGGGTTGTGAGG - Intergenic
940137198 2:150451393-150451415 ATTCTTTGTGTTACTTTTTGAGG + Intergenic
940734481 2:157434230-157434252 ATTCAGTGTGTGGCTGTTTGGGG - Intronic
941068039 2:160925261-160925283 TTTCTTGGTGTGGCTTTTCTTGG - Intergenic
942003041 2:171669384-171669406 ATTCTTTGACTGGCTTTTTGGGG + Intergenic
942882373 2:180876646-180876668 TTTCCTGATGTGGCTTTGTCTGG - Intergenic
942969399 2:181939433-181939455 ATACCATGTGTGACTTTTTGTGG + Intergenic
943334158 2:186593369-186593391 ATTTCTGGAGTGATTTTTTGAGG - Intronic
945252595 2:207777113-207777135 AATTCTGGTGTGGCCTCTTGTGG + Intergenic
945745502 2:213715705-213715727 ATTAGTTGTATGGCTTTTTGAGG + Intronic
1169335176 20:4749907-4749929 TTTCCAGGGATGGCTTTTTGGGG + Intergenic
1171167354 20:22983762-22983784 AGTCCTGGTAAGGCATTTTGTGG + Intergenic
1171508307 20:25657833-25657855 ATTTTTGGTTTGTCTTTTTGGGG + Intergenic
1172091035 20:32433006-32433028 AGTCCTGGTCTGGGGTTTTGAGG + Intronic
1173238337 20:41269470-41269492 TTTCCTGGTGTGGATTCTAGAGG + Intronic
1174287113 20:49481645-49481667 CTTCTTGCTGTGGCTTTTTATGG + Intronic
1174488416 20:50875352-50875374 GTTTCTGGTGAGGATTTTTGTGG - Intronic
1174858412 20:54068143-54068165 ATTCCTGGTATGGGACTTTGTGG + Intronic
1174925459 20:54754557-54754579 CTTCCTGGTTTAGCTTTTGGAGG - Intergenic
1175724941 20:61311203-61311225 ATTGCTGGTGTGGGTGTGTGTGG - Intronic
1176137272 20:63529772-63529794 ATGGCTGGTGTGGCTTCTTGGGG - Intronic
1177533889 21:22399394-22399416 ATTCATTATGTGGGTTTTTGGGG + Intergenic
1179962055 21:44773094-44773116 CTTCCTGGTGGGGCTGTCTGGGG - Intronic
1181341379 22:22182497-22182519 ATTCCTGGTATGAGTTTGTGAGG - Intergenic
1181612174 22:24023427-24023449 ATTCCATGTCTGACTTTTTGAGG + Intronic
1181768337 22:25108332-25108354 ATTTCTGGTGTGACTTTTCTGGG + Intronic
1182751401 22:32644781-32644803 ATTCCTGGGGTGGCTGCCTGGGG + Intronic
1183399063 22:37590540-37590562 ATTCCATGTTTAGCTTTTTGAGG - Intergenic
1184621091 22:45677908-45677930 ATTCCATGTTTAGCTTTTTGAGG - Intronic
950849429 3:16048604-16048626 ATGCCTGGACTGGCCTTTTGGGG - Intergenic
950866419 3:16192994-16193016 ATTCCTGGTTTTGCTCATTGTGG + Intronic
951548545 3:23853770-23853792 ATTCCTGGTGGTGGTTTTTCAGG + Intronic
951705946 3:25544682-25544704 ATTACTGAAGTGGCATTTTGAGG - Intronic
953619912 3:44524331-44524353 ATTCCAGCTGTTGCATTTTGTGG - Intergenic
955706205 3:61730323-61730345 CTTCCTGGTGTGGGTTTTGAAGG - Intronic
955722614 3:61899599-61899621 ATTCCTGGTGAGTCTTCTGGAGG - Intronic
955919904 3:63944635-63944657 ATTCATGGTTTTGCTTTCTGAGG - Intronic
957153996 3:76523256-76523278 ATTTGTAGTGTGGATTTTTGAGG + Intronic
957651449 3:83011160-83011182 ATTCCTTGTGTGGTACTTTGTGG + Intergenic
957745093 3:84330345-84330367 ACTCCTGGTGTAGCTATTTTTGG + Intergenic
959395154 3:105827906-105827928 ATTTCTGCTGTGTTTTTTTGAGG - Intronic
959802681 3:110513521-110513543 TCTCCTGGTGAGGCTTTGTGAGG - Intergenic
960275423 3:115723692-115723714 ATTCTTGGTATGTCTTTTGGGGG - Intergenic
960348718 3:116567362-116567384 ATTCATAGGGTGGCTTTTTAAGG - Intronic
960678662 3:120224035-120224057 TTTCCTGCTGTAGATTTTTGTGG + Intronic
961953590 3:130775992-130776014 TTTATTGCTGTGGCTTTTTGGGG - Intergenic
962906845 3:139811453-139811475 ATTCCTGGTTTAGATCTTTGTGG + Intergenic
963851185 3:150212140-150212162 GTTCCTGGTGTGGATTGTTCTGG - Intergenic
967649302 3:191965942-191965964 ATTCATCGTGTGGCTTTTGTGGG - Intergenic
968001968 3:195212389-195212411 GCACCTGGTGTGGCCTTTTGGGG + Intronic
968501809 4:953640-953662 ATTCCGGGTGTCGCTGTTTCTGG - Intronic
970294913 4:14618665-14618687 ATTCCTGGTGTGGTTTCATGAGG + Intergenic
971016592 4:22495461-22495483 ATTCATGGTTTTGCTTTCTGTGG - Intronic
971784792 4:31086077-31086099 ATTCCTGGTTTTGCTTTGTTTGG + Intronic
972080370 4:35141847-35141869 ATTCCTGCTGGGACCTTTTGTGG - Intergenic
973029556 4:45319607-45319629 ATTTTTGGTGTGTCTTTTTGTGG + Intergenic
974189986 4:58492349-58492371 ATTCATTATGTGGTTTTTTGGGG - Intergenic
975152099 4:71033590-71033612 ATTCCTGTTGTGGCGTTTGAGGG - Intergenic
976795672 4:88930166-88930188 ATTCCTCATCTGGCATTTTGAGG + Intronic
977846812 4:101776760-101776782 ATTCCTGGTGTGTGTCTGTGAGG + Intronic
978439884 4:108722258-108722280 ATTCCTGGAATGAATTTTTGGGG + Intergenic
978934403 4:114357920-114357942 CTTTCAGGTTTGGCTTTTTGAGG + Intergenic
978971721 4:114815643-114815665 GGTCCAGGTATGGCTTTTTGTGG - Intergenic
980680585 4:136155077-136155099 ATTCTTGGTGTGGCTCCATGTGG + Intergenic
980966070 4:139522367-139522389 AGTCTTGATGTGGCTTTTTCTGG - Intronic
982455042 4:155599392-155599414 TTTCCTGGTTTTGTTTTTTGGGG + Intergenic
983420603 4:167510499-167510521 ATTCCTGCTGTGTCTTCTTGAGG + Intergenic
985610708 5:886453-886475 ATTCTTGGTGTAGCTTATTCTGG - Intronic
985882924 5:2654206-2654228 ATTACTGGTGGGCGTTTTTGTGG - Intergenic
988919450 5:35926879-35926901 ATTCCTGGTTTTCCTTTTTCAGG + Intronic
989127117 5:38065822-38065844 ATTCTTTTTGTGGCTTTTTGTGG + Intergenic
989482357 5:41946731-41946753 ATTCTTGGTGGGGATGTTTGGGG - Intergenic
990862220 5:60339555-60339577 ATTTCAAGTTTGGCTTTTTGTGG - Intronic
992793623 5:80236424-80236446 ATTTTTGGTGTGGATTTTTTAGG - Intronic
993857410 5:93093641-93093663 ATTCCTGATGTGGAATTTTCAGG - Intergenic
995527719 5:113063980-113064002 TTACCTGGTGTGGCTGTTGGAGG + Exonic
996017398 5:118555599-118555621 ATTCCAGGAGTGGCTGTTTATGG - Intergenic
997615091 5:135240676-135240698 TTTCCTGGAGAGGCTCTTTGGGG + Intronic
997783916 5:136688774-136688796 ATTCTTTGTATGGTTTTTTGGGG - Intergenic
999456885 5:151724390-151724412 ATTTCTGCAGTGGCTTCTTGGGG - Intergenic
1000517952 5:162262743-162262765 ATTTTTGGTGTGGCTTTTTCTGG - Intergenic
1000813580 5:165891907-165891929 AGTCTTTGTGTGGATTTTTGTGG + Intergenic
1001185360 5:169566360-169566382 ATTCCTGGTATGCATCTTTGTGG + Intergenic
1001450400 5:171820196-171820218 AAGCCTGGTGTGCCTTTTTGGGG + Intergenic
1002980244 6:2128865-2128887 TTTCCCGGTCTGGGTTTTTGGGG + Intronic
1003236234 6:4297542-4297564 ATTCCTGGTGTGCCTGTGTTGGG - Intergenic
1003335846 6:5171491-5171513 ATTCCTGGTGTGTGTGTTAGGGG + Intronic
1004094091 6:12535546-12535568 ATTTCTGGAGTGTCTTTTAGAGG - Intergenic
1005474757 6:26196932-26196954 CTACCTGGTGGGGCTGTTTGAGG - Exonic
1005480457 6:26250287-26250309 TTACCTGGTGGGGCTCTTTGAGG - Exonic
1005642560 6:27810370-27810392 CTACCTGGTGGGGCTCTTTGAGG + Exonic
1005649305 6:27871997-27872019 CTACCTGGTGGGGCTATTTGAGG - Exonic
1009389598 6:63130209-63130231 ATTGCTGGTGTGATCTTTTGGGG + Intergenic
1011574018 6:88774418-88774440 ATTCTGTGTTTGGCTTTTTGAGG - Intronic
1011847608 6:91585797-91585819 AGTCCTTTTGTGACTTTTTGGGG - Intergenic
1012668796 6:102014141-102014163 ATTCCTGGTTTAGTTTTTGGAGG + Intronic
1012866994 6:104630396-104630418 ATTTATGGGGTGGCTTTTTTAGG - Intergenic
1013438902 6:110141099-110141121 ATTCATGGTTTTGCTTTCTGTGG - Intronic
1015941263 6:138454545-138454567 AATCCTGGTTTTGCTTTTAGGGG + Intronic
1016617206 6:146065217-146065239 ATTCCTGGTGTTGATTTTGGAGG + Intronic
1018002691 6:159593691-159593713 ATTCCTGGTGTGTTTTCTGGTGG - Intergenic
1018045502 6:159962555-159962577 AATCATGGTGTGGCATTTTGGGG + Intergenic
1018144048 6:160866245-160866267 ATTCATGGTTTTGCTTTCTGTGG + Intergenic
1018448658 6:163883826-163883848 ATTATTGGTTTGGTTTTTTGAGG - Intergenic
1018552215 6:165010782-165010804 ATTCCTGCTCTTGCTTTCTGAGG - Intergenic
1020363459 7:7354471-7354493 GTTCCTCCTGTTGCTTTTTGAGG - Intergenic
1021114021 7:16728671-16728693 GTTCCAGGTGTGGCTGTTTTGGG - Intergenic
1022707079 7:32812183-32812205 CTTCCTCACGTGGCTTTTTGTGG + Intergenic
1023212448 7:37821803-37821825 ATTCTTTGTTTAGCTTTTTGAGG + Intronic
1024182480 7:46909915-46909937 ATTCAGTGTGTGGCTTTTGGCGG + Intergenic
1025325727 7:58216732-58216754 ACTCCTGCTGTGGCATTTTCAGG + Intergenic
1025368592 7:58975833-58975855 ACTCCTGCTGTGGCATTTTCAGG + Intergenic
1025380789 7:59192165-59192187 ACTCCTGCTGTGGCATTTTCAGG + Intergenic
1025381137 7:59198301-59198323 ACTCCTGCTGTGGCATTTTCAGG + Intergenic
1025384993 7:59266763-59266785 ACTCCTGCTGTGGCATTTTCAGG + Intergenic
1025385166 7:59269829-59269851 ACTCCTGCTGTGGCATTTTCAGG + Intergenic
1025386109 7:59286518-59286540 ACTCCTGCTGTGGCATTTTCAGG + Intergenic
1025421385 7:59912179-59912201 ACTCCTGCTGTGGCATTTTCAGG + Intergenic
1025453916 7:60490668-60490690 ACTCCTGCTGTGGCATTTTCAGG + Intergenic
1025461270 7:60621847-60621869 ATTCTTGCTGTGGCATTTTCAGG + Intergenic
1027590063 7:80107571-80107593 ATTGAGGATGTGGCTTTTTGAGG + Intergenic
1027793132 7:82658066-82658088 ATTCCAGGTTTTGCTTTCTGAGG + Intergenic
1028281983 7:88941822-88941844 ATCTTTGATGTGGCTTTTTGTGG + Intronic
1029290385 7:99497981-99498003 CTTCCTGGTTTTGCTTTCTGCGG - Intronic
1029930025 7:104361173-104361195 ATTTATGATCTGGCTTTTTGCGG + Intronic
1030112883 7:106041490-106041512 ATTGCTGCTGTGGTTTTTTGCGG - Intergenic
1031402899 7:121346431-121346453 ATTGCTGGTCTGGCCTTTAGGGG - Intergenic
1033169593 7:139071882-139071904 ATTCATGGTAGGGCTGTTTGTGG + Intronic
1036776529 8:11616755-11616777 ATTACTGGTATAGCTTTCTGTGG - Intergenic
1039964163 8:42271636-42271658 CTCCCTGGGGTGGCTTCTTGGGG + Intronic
1040978336 8:53218811-53218833 ATTCATTGTCTGGCTTTCTGTGG + Intergenic
1041019008 8:53619181-53619203 ATCCCTGTTGTAACTTTTTGCGG - Intergenic
1041991475 8:63997442-63997464 AGTCCTGATTTGGCTTCTTGTGG + Intergenic
1043127313 8:76415261-76415283 ATTCATGGTTTTGCTTTCTGTGG - Intergenic
1044778474 8:95719083-95719105 ATTCCTAGTTTGGCTATTTTAGG - Intergenic
1044921341 8:97172575-97172597 TATCCTGGTGTCTCTTTTTGTGG - Intergenic
1045015083 8:97994351-97994373 CTTCATGGTGTGACTCTTTGAGG + Intronic
1045263895 8:100602903-100602925 ATTCTTGGTCTTGCTTTCTGTGG - Intronic
1046164392 8:110411637-110411659 ATTGCTGTTGTGGCTATGTGTGG - Intergenic
1047620451 8:126601346-126601368 ATCCTTGGTGTCCCTTTTTGTGG + Intergenic
1051933906 9:22421272-22421294 TTTCCTGGTTTGTATTTTTGTGG + Intergenic
1052073795 9:24115754-24115776 ATATCTGGTATGGTTTTTTGAGG + Intergenic
1053471696 9:38351022-38351044 ATTCCTTGTGTAGCCCTTTGTGG - Intergenic
1054196664 9:62038754-62038776 ATTCCTGTTCTTGCTTTCTGAGG + Intergenic
1054641741 9:67549931-67549953 ATTCCTGTTCTTGCTTTCTGAGG - Intergenic
1055590454 9:77807523-77807545 ATTCTTTGTGTGGCATTTAGTGG + Intronic
1057444795 9:95106011-95106033 ATTCCAAGTTTGGCTGTTTGAGG + Intronic
1058554739 9:106154976-106154998 ATTCCTTGTGCTGCTTTTTCTGG + Intergenic
1060650338 9:125320428-125320450 GTTTCTGGTGTGGACTTTTGTGG + Intronic
1061330452 9:129889126-129889148 TTTCCCTGTGTGGGTTTTTGAGG - Exonic
1185508291 X:644554-644576 ATTCTTGCTGTTGCTTTTGGCGG - Exonic
1186727329 X:12371240-12371262 ATTCCTATTGTGATTTTTTGGGG - Intronic
1188028775 X:25240323-25240345 CTTCCTTGTGTGCCTTTTGGGGG - Intergenic
1188173987 X:26965227-26965249 ATTCCTACTGTGGATTTTTGTGG - Intergenic
1188449835 X:30297181-30297203 TTTCGTTGTGTGGCTTTTGGGGG + Intergenic
1188559281 X:31449646-31449668 ACTCCTGCTGTGGCCTTTTATGG - Intronic
1189408875 X:40751570-40751592 ATTTATTGTGGGGCTTTTTGAGG + Intergenic
1190373516 X:49765897-49765919 CTTCCTGGTGTTCCTTTTTAGGG + Intergenic
1191182936 X:57581720-57581742 ATTGCTGATGTGTATTTTTGTGG - Intergenic
1191214436 X:57920655-57920677 ATTGCTGATGTGTATTTTTGTGG + Intergenic
1192128273 X:68522865-68522887 CTTCATGGTTCGGCTTTTTGTGG + Exonic
1193971460 X:88060069-88060091 AGTACTGGTGTGCCTTTTAGTGG + Intergenic
1195902512 X:109813797-109813819 AATCCTGGTGTGGGCTTGTGGGG - Intergenic
1197979413 X:132199670-132199692 ATTCCTGGAGGGGCTTTCTGGGG + Intergenic
1198155939 X:133960878-133960900 ATGCCTGTTATGGCTTTTTTTGG - Intronic
1198294749 X:135275473-135275495 ATTCATTGTGTGGTTTTTTTGGG + Intronic
1198540594 X:137635181-137635203 ACTTCTGGTTTGGCTTTTTCTGG + Intergenic
1201168859 Y:11237454-11237476 ACTCCTGTTGGGGCCTTTTGCGG + Intergenic
1201971016 Y:19795080-19795102 CTTCCTGGTTTGGTTTTGTGAGG + Intergenic
1202603536 Y:26618723-26618745 AGCCCTGGTGTGGCTTTAGGGGG + Intergenic