ID: 1088308830

View in Genome Browser
Species Human (GRCh38)
Location 11:108438591-108438613
Sequence ATTTTCTTCTAGGAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24006
Summary {0: 9, 1: 140, 2: 1479, 3: 15880, 4: 6498}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088308830_1088308838 23 Left 1088308830 11:108438591-108438613 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 1088308838 11:108438637-108438659 TGGATTTGGTAATGATTTCTTGG 0: 4
1: 84
2: 283
3: 455
4: 871
1088308830_1088308836 3 Left 1088308830 11:108438591-108438613 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 1088308836 11:108438617-108438639 GGGGAAAAGCTTCATGACGTTGG 0: 2
1: 25
2: 188
3: 658
4: 1607
1088308830_1088308837 9 Left 1088308830 11:108438591-108438613 CCATAAAACTCCTAGAAGAAAAT 0: 9
1: 140
2: 1479
3: 15880
4: 6498
Right 1088308837 11:108438623-108438645 AAGCTTCATGACGTTGGATTTGG 0: 2
1: 54
2: 324
3: 703
4: 1482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088308830 Original CRISPR ATTTTCTTCTAGGAGTTTTA TGG (reversed) Intronic
Too many off-targets to display for this crispr