ID: 1088318061

View in Genome Browser
Species Human (GRCh38)
Location 11:108527376-108527398
Sequence CTTTTTGCAAAGAGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 405}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088318054_1088318061 21 Left 1088318054 11:108527332-108527354 CCTCTGTTTATATGCACTCCTCC 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1088318061 11:108527376-108527398 CTTTTTGCAAAGAGAGAGGGAGG 0: 1
1: 0
2: 3
3: 51
4: 405
1088318056_1088318061 0 Left 1088318056 11:108527353-108527375 CCTCACCAGAATTTTACCTCATG 0: 1
1: 0
2: 3
3: 15
4: 182
Right 1088318061 11:108527376-108527398 CTTTTTGCAAAGAGAGAGGGAGG 0: 1
1: 0
2: 3
3: 51
4: 405
1088318057_1088318061 -5 Left 1088318057 11:108527358-108527380 CCAGAATTTTACCTCATGCTTTT 0: 1
1: 0
2: 1
3: 34
4: 334
Right 1088318061 11:108527376-108527398 CTTTTTGCAAAGAGAGAGGGAGG 0: 1
1: 0
2: 3
3: 51
4: 405
1088318055_1088318061 3 Left 1088318055 11:108527350-108527372 CCTCCTCACCAGAATTTTACCTC 0: 1
1: 0
2: 0
3: 9
4: 199
Right 1088318061 11:108527376-108527398 CTTTTTGCAAAGAGAGAGGGAGG 0: 1
1: 0
2: 3
3: 51
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088318061 Original CRISPR CTTTTTGCAAAGAGAGAGGG AGG Intronic
900252158 1:1676557-1676579 GTTTTTGCCAAGAGCGACGGCGG - Exonic
900262568 1:1739415-1739437 GTTTTTGCCAAGAGCGACGGCGG - Exonic
900439344 1:2645560-2645582 CTTCCTGCAAGGAGGGAGGGCGG + Exonic
900459271 1:2793629-2793651 TTTTTTGCAAGGTGAGAGGTAGG + Intronic
901965545 1:12863170-12863192 CATTTTGCAATGAGAGGGTGTGG - Intronic
902166921 1:14579958-14579980 CCTTTTGCCAAGTGGGAGGGGGG + Intergenic
902483349 1:16724470-16724492 TTTTTGGCATAGAGAGAGAGAGG + Intergenic
902526846 1:17064391-17064413 CACCTTGCAGAGAGAGAGGGGGG + Intergenic
902566579 1:17315447-17315469 CTTTTTGCAACAAGAGCAGGCGG + Intronic
903444369 1:23411977-23411999 ATTTTAGCAAAGACAGAGCGGGG - Intronic
903980131 1:27180248-27180270 CAGTTTGCACAGAGAGAGAGAGG - Intergenic
904025248 1:27498802-27498824 CTTTTTTTAAATAGAGATGGGGG + Intergenic
905031422 1:34886431-34886453 CTCTTTGCAAAGAAAGATGGGGG + Intronic
905284246 1:36868960-36868982 CTTTTTGAAAAGCGACAGGATGG + Intronic
905889190 1:41509209-41509231 TTTTTTAAAAAGAGAGAGGATGG - Exonic
908524360 1:64973605-64973627 TTTTTTGCAAAGTGAGACGAGGG - Intergenic
908956639 1:69637966-69637988 AGTTTTGCAAAGAGAGAGAAAGG + Intronic
909883554 1:80911385-80911407 ATTTTTGTAAAGAAAGAGGAAGG + Intergenic
909908750 1:81233846-81233868 CACTTTGGAGAGAGAGAGGGAGG - Intergenic
910122527 1:83806264-83806286 CTTTTTGGAAAGAAACAGGTAGG + Intergenic
910667852 1:89743463-89743485 ATTTTTGACAAGACAGAGGGAGG - Intronic
912111166 1:106345090-106345112 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
912174959 1:107142896-107142918 CCTTTGCCAAAGAGAAAGGGAGG - Intronic
913222806 1:116672605-116672627 CTTTTTTTAAAGACAGATGGTGG - Intergenic
913508168 1:119538348-119538370 ATTTTTGCAAAAAAAGAGGGTGG + Intergenic
914687838 1:149997526-149997548 CTTCTTGCAGGGAGAGTGGGGGG + Intronic
915218476 1:154355596-154355618 CGTTTTGGAGAGAGAGAGAGAGG - Intergenic
916121639 1:161533368-161533390 CCTTTTGCCAGCAGAGAGGGGGG - Intergenic
916881729 1:169025385-169025407 CTATTTTTAAATAGAGAGGGAGG + Intergenic
917076821 1:171214467-171214489 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
917630620 1:176887992-176888014 CTATTTGCAAAGAAATAGGCTGG - Intronic
918678771 1:187324811-187324833 CTATTAGGAAAGATAGAGGGGGG - Intergenic
919898711 1:202027342-202027364 CTTTTTAAAAATAGAGATGGGGG - Intergenic
921620984 1:217325981-217326003 CATTTTTCAAAGACAGAGAGGGG + Intergenic
922039256 1:221880196-221880218 CATTTTACAAAGAAAGAGGCTGG + Intergenic
922084410 1:222332375-222332397 CCTTTTCCAGAGAGTGAGGGAGG - Intergenic
922126990 1:222737499-222737521 CTCTCTGCAGAGAGAGAGGGCGG + Intronic
922414299 1:225406491-225406513 CATTTTGCAAAGAGAATGGATGG - Intronic
922567780 1:226612123-226612145 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
923001058 1:230006741-230006763 GTTTTTGAAGAGAGAGAGAGAGG - Intergenic
923913918 1:238481781-238481803 CAGTTTGCAAAGGGAGAAGGAGG + Intergenic
923985309 1:239375336-239375358 CTTTTTTTTAAGAGAGAGGGGGG + Intergenic
924353367 1:243142202-243142224 CTTCATGCAAACAGGGAGGGTGG + Intronic
924375767 1:243406822-243406844 GTTTGTGCAAAGACACAGGGTGG - Intronic
924566909 1:245206355-245206377 CTTTGTGCAAAGATAAAGGAGGG - Intronic
1063020940 10:2127093-2127115 CATTATGCAAACAGAGAGGGTGG - Intergenic
1064110152 10:12531613-12531635 CATTTTGCACAGAAAGAGCGTGG + Intronic
1064306767 10:14174306-14174328 GATTATGGAAAGAGAGAGGGAGG - Intronic
1065705696 10:28469791-28469813 TTTTTTGCAGAGAGAGACGGAGG + Intergenic
1068031513 10:51710869-51710891 CTTTTTGTTAATAGAGATGGGGG + Intronic
1069536495 10:69257483-69257505 CTTTTAACATAGTGAGAGGGTGG + Intronic
1069659082 10:70111742-70111764 CTTTTTAAAAGGAGAGAGGAGGG + Exonic
1070005982 10:72424488-72424510 TTTTTTGTAAATAGAGATGGGGG + Intronic
1071012298 10:80953051-80953073 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1071054917 10:81498481-81498503 TTTTTTTCAAAAAAAGAGGGAGG + Intergenic
1071083696 10:81842794-81842816 CTTTTTGCAGTGAGAGAGGAAGG - Intergenic
1073456906 10:103642834-103642856 TTTTTAGCAAAGAGAGAAAGGGG - Intronic
1074740323 10:116480085-116480107 ATTTTTAAAAAGAGAGAGAGTGG - Intergenic
1074763705 10:116685695-116685717 CTTTATGTAGAAAGAGAGGGAGG + Intronic
1077538241 11:3134605-3134627 CTTTTGGAAAGGAGGGAGGGAGG + Intronic
1078908449 11:15709013-15709035 TTTTTTGCCAAGAGAGTGGACGG - Intergenic
1079302245 11:19288286-19288308 CATTTTGGAGAAAGAGAGGGAGG - Intergenic
1079501674 11:21107671-21107693 CCTCTTGCAAAAAGAGGGGGTGG + Intronic
1080196151 11:29611830-29611852 CATTTTGCATAGAAAGAGGATGG - Intergenic
1080810734 11:35701843-35701865 CAGTTTGCACAGAGAGAGAGAGG + Intronic
1084173948 11:67413804-67413826 TTTTTTTTAAAGAGATAGGGGGG + Intronic
1084590502 11:70087415-70087437 CTTTTTGCAAGCAGCCAGGGAGG + Intronic
1084755783 11:71237787-71237809 CTTTTACCAAAGAGAGAGAGAGG - Intronic
1084875388 11:72128555-72128577 CATTTTGCACAGGGAGAGAGAGG + Intronic
1085614194 11:77982564-77982586 GTTTTAGCTTAGAGAGAGGGAGG + Intronic
1085636880 11:78165786-78165808 CTTTTTCTATAGAGAGAGAGGGG + Intergenic
1085824017 11:79823862-79823884 ATTTTTGCAAAGAGAATGGGTGG - Intergenic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1086225024 11:84497477-84497499 CTTTTTTCTAAGAGAGATAGGGG + Intronic
1088318061 11:108527376-108527398 CTTTTTGCAAAGAGAGAGGGAGG + Intronic
1090284358 11:125486367-125486389 CTTATGGCAAAGGAAGAGGGTGG + Intronic
1090539365 11:127683663-127683685 GTTTTTGAAAATAGAGAGGTCGG + Intergenic
1093140782 12:15508251-15508273 CTTTTAACAAAGAGTGAGCGTGG - Intronic
1093354638 12:18151774-18151796 GTTTTTGCAAAGACACAGGCAGG + Intronic
1094218755 12:27971390-27971412 CTTTTTGAAAAGAGCGCGAGTGG + Intronic
1095398214 12:41785500-41785522 CTTTTTGAAAAGAGAAAAGCAGG + Intergenic
1096566556 12:52486959-52486981 CTTTTGGCAAATGGAGTGGGAGG - Intergenic
1096578368 12:52568981-52569003 CCTGTTGCTAACAGAGAGGGAGG + Intronic
1098151000 12:67546424-67546446 CTTTTTGCCAAGGAAGAGTGAGG - Intergenic
1098662168 12:73108944-73108966 CATTTTGTAAAAAGAAAGGGAGG + Intergenic
1098763316 12:74452864-74452886 CATTTTGAAAATAGAGAGTGAGG - Intergenic
1098805507 12:75016468-75016490 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1099668290 12:85658952-85658974 GTTTTAGCAAAGAGAGTGAGTGG + Intergenic
1099676336 12:85765334-85765356 CTTTTTGCAAATAAAGAGTGAGG + Intergenic
1100123807 12:91398925-91398947 TCTTTTGCAAAGAGAGAGAGTGG - Intergenic
1100447929 12:94678470-94678492 CTTTTTGCAGATAGAGAAGAGGG - Intergenic
1100700989 12:97147845-97147867 AATTTGGCAAGGAGAGAGGGAGG + Intergenic
1100815812 12:98386106-98386128 CTCTCTGCAGAGAGAGAGAGGGG - Intergenic
1101666357 12:106819269-106819291 CTTTATTTAAAGTGAGAGGGAGG - Intronic
1101669227 12:106851577-106851599 TCCTTTGCAAAGAGAGAGGTAGG + Exonic
1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG + Intergenic
1101893515 12:108736268-108736290 CTCATTAAAAAGAGAGAGGGAGG + Intergenic
1102249496 12:111376581-111376603 CTGTTTAAAAAGAGAGAGAGAGG + Intergenic
1102549064 12:113677839-113677861 TTTTTGGCAGAGAGTGAGGGCGG + Intergenic
1103981620 12:124740526-124740548 CCTTTTGCAAACAGAGAGCCTGG + Intergenic
1104237830 12:126956518-126956540 CTTTCAGCAAATAGAGAGGGAGG - Intergenic
1104739135 12:131159856-131159878 CCTTTGGGAAAGGGAGAGGGTGG - Intergenic
1105741260 13:23325623-23325645 CATTTTACAAAGTGAGTGGGTGG - Intergenic
1107433902 13:40365016-40365038 CTTTTTGACAAGAGAGAGGAAGG - Intergenic
1107895347 13:44956391-44956413 ATTTTTCCAAAGACAGAGGGTGG + Intronic
1108349956 13:49582847-49582869 CTTTTTGCTAAGAGTAAGAGGGG + Intronic
1109013016 13:56974655-56974677 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1109756315 13:66765140-66765162 ATTTTAGAAAAAAGAGAGGGAGG - Intronic
1111325893 13:86695488-86695510 GTTTTAGCAAAGAGACTGGGAGG - Intergenic
1111758445 13:92429834-92429856 TTTTTTACAAAGAGAGATGTTGG + Intronic
1112367973 13:98772029-98772051 CTGTTTGCTTTGAGAGAGGGTGG + Intergenic
1113195165 13:107795289-107795311 CATCTTGCAAAGAAAGAGGGGGG + Intronic
1113258371 13:108532445-108532467 GTTTTTGAGAAGAGAGAGTGTGG + Intergenic
1115769231 14:36653849-36653871 TTTTTTCTAACGAGAGAGGGGGG - Intergenic
1116233399 14:42247437-42247459 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
1117228408 14:53688039-53688061 CTATTTACAAAGAGAAAGGAAGG + Intergenic
1117282777 14:54256782-54256804 CTTTTTGCAAAGGTAGAATGTGG - Intergenic
1117308315 14:54497834-54497856 TGGTTTGCACAGAGAGAGGGAGG + Intergenic
1117692120 14:58318604-58318626 CATTTTGCAGAGAGTGAGGTAGG + Exonic
1118746320 14:68776076-68776098 CTGTTTACAAAGACAGATGGTGG - Intergenic
1119877747 14:78074990-78075012 CTTTAGGGAAAGAGAGATGGGGG + Intergenic
1120314352 14:82872456-82872478 CAATTTGCACAGGGAGAGGGAGG - Intergenic
1121302291 14:92881334-92881356 CTCTGTGCAAAGAGGGAGGTGGG - Intergenic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1122332748 14:100935288-100935310 CATTTTGCATAGAAATAGGGGGG - Intergenic
1123831706 15:24145876-24145898 TTTTTTCCAGAGAGACAGGGAGG + Intergenic
1125107444 15:35989558-35989580 TTTTTTGCAAAGAGAGGTTGTGG - Intergenic
1125589816 15:40847117-40847139 CTGTTTGCCACAAGAGAGGGTGG + Intronic
1127160400 15:56177693-56177715 AGTATTGCAAAGAGAGTGGGTGG + Intronic
1127349600 15:58137218-58137240 CTTTTTGCAAAGCTAGGGGAGGG + Intronic
1127649771 15:60995540-60995562 CTTTTTACTAAGTGAGCGGGAGG - Intronic
1127664496 15:61132033-61132055 TATTTTAAAAAGAGAGAGGGAGG - Intronic
1127858406 15:62972150-62972172 TGTTTTGCAAACAGAGAGGATGG - Intergenic
1128042404 15:64586653-64586675 ATTTTTCCACAGACAGAGGGGGG - Intronic
1128180543 15:65599930-65599952 CTGTTTGTAAAAAGAGAGAGAGG + Intronic
1128372181 15:67048597-67048619 CTCTTTGCAAAGGGACAGGTTGG - Intergenic
1130630220 15:85560317-85560339 TTTTTTGCAAAGAGTGGGGGTGG + Intronic
1130754120 15:86744685-86744707 CTCAGTGCAAAGAGGGAGGGTGG - Intronic
1130913136 15:88284580-88284602 CTTCTTGCAGAGAGAGGGGGTGG - Intergenic
1131454613 15:92573385-92573407 CTATTTCCACAGAGAGAGGCCGG - Intergenic
1131813976 15:96203201-96203223 CTCTTTGCAAAGGCAGAGAGAGG - Intergenic
1133175171 16:4009076-4009098 ATTTTTACAAGGAGAGAGGGAGG - Intronic
1133414695 16:5597296-5597318 CTGTCTCAAAAGAGAGAGGGCGG - Intergenic
1133465865 16:6026369-6026391 CATTTTGCAGATAGAGAGTGGGG + Intronic
1134341476 16:13350740-13350762 ATTTTTGCAAAGAAAGAGTGAGG + Intergenic
1134538263 16:15044033-15044055 ATTTTTGCCAGGAGGGAGGGTGG + Intronic
1135481574 16:22824988-22825010 CTTATTGGAGAGAGAGAGAGAGG + Intronic
1135849223 16:25947688-25947710 TTTTTTGGAACGAGAGAGGAAGG + Intronic
1137658854 16:50185729-50185751 CCTTAAGAAAAGAGAGAGGGAGG - Intronic
1139272736 16:65698958-65698980 CTGTCTGCAGAGAGAGAGAGAGG + Intergenic
1142326624 16:89419758-89419780 CGTTTTGCAAAGATGGAGTGAGG + Intronic
1143444451 17:6999126-6999148 CTTCTTGCAAAGAGTTACGGGGG - Intronic
1145827037 17:27884843-27884865 CTTTTTGCAAGGTGAGGGGAGGG - Intronic
1146129472 17:30258974-30258996 TTTTCTGAAAAGGGAGAGGGAGG - Intronic
1146321469 17:31850099-31850121 CTTTTAGCAAAGACAGTGGAAGG + Intergenic
1146511538 17:33453441-33453463 CTTTTTGAAAAGAGGCAGGGAGG + Intronic
1147756700 17:42773355-42773377 CTTTCTGGAAAGAGAGAGACCGG - Intergenic
1147887547 17:43694616-43694638 CCTTCTGCAGAGAGAGAGAGAGG + Intergenic
1148548066 17:48531717-48531739 ATTTATGCAAAGAGAGAGAGAGG - Intergenic
1149030778 17:52079993-52080015 CTATTTCCAAAGAGAGAAGATGG + Intronic
1149559577 17:57598973-57598995 ATTTTTAAAAAGAGAGAGAGAGG + Intronic
1150485295 17:65538959-65538981 TTCTGTACAAAGAGAGAGGGAGG - Intronic
1151341500 17:73474037-73474059 CTTTTTGAAAAAAGAGATGGGGG + Intronic
1153092231 18:1360417-1360439 CTTTTTGTTAAAAGAGGGGGAGG + Intergenic
1155713641 18:28912517-28912539 CTGTTTGCACAGAAAGAGAGAGG - Intergenic
1155927990 18:31678334-31678356 CTTATTGAAAAGAGAGAGAGAGG - Intronic
1156698454 18:39795769-39795791 CAGTTTGCAGAGGGAGAGGGAGG + Intergenic
1156972240 18:43170546-43170568 CACTTTGCATGGAGAGAGGGAGG - Intergenic
1159120005 18:64157859-64157881 GTTTTGGGAAAGAGGGAGGGTGG + Intergenic
1159308280 18:66674312-66674334 CTATTAGCAGAGAGAAAGGGGGG - Intergenic
1159431443 18:68357912-68357934 CATTCTGCATAGGGAGAGGGAGG - Intergenic
1159454966 18:68649661-68649683 TTTTTTGCCAAGGGAGTGGGCGG - Intergenic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1160177621 18:76608810-76608832 TTTTTTTGAAAGAGAGATGGTGG + Intergenic
1160225243 18:77006858-77006880 GTGTTTGCACAGAGAGAGAGAGG + Intronic
1161136919 19:2625388-2625410 TTTTTTGCAGAAATAGAGGGGGG + Intronic
1161546144 19:4881429-4881451 TTTTTTTCAAATAGAGATGGGGG - Intergenic
1161660335 19:5541836-5541858 CTTTCTGCAGAGAGGAAGGGAGG + Intergenic
1161719548 19:5895368-5895390 CTCTTTGAAGAGAGACAGGGAGG + Intronic
1161969606 19:7570069-7570091 ATTTTTTCAAAGTGAGATGGCGG + Intergenic
1162004290 19:7767437-7767459 CTTTCTGCCAAGAGACGGGGAGG + Intronic
1164834079 19:31346028-31346050 CTTTTCTCAAAGAGAAAGAGAGG - Intronic
1164864653 19:31594340-31594362 AATCTTGCATAGAGAGAGGGTGG + Intergenic
1165285027 19:34834481-34834503 TTTTTTTTAAAGAGAGATGGGGG - Intergenic
1166397997 19:42456585-42456607 CTTTTTGCCAAAAGAGATTGAGG + Intergenic
1168617813 19:57852503-57852525 CTTTTTGTAAAGAGACAGCTAGG + Intronic
1168625443 19:57914524-57914546 CTTTTTGTAAAGAGACAGCTAGG - Intronic
926500628 2:13648847-13648869 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
926859481 2:17293098-17293120 CTTTTTGCAAAAATTAAGGGAGG - Intergenic
926926994 2:17996825-17996847 CAGTTTGCACAGGGAGAGGGAGG - Intronic
927576875 2:24207814-24207836 CTGGCTGCAAAGGGAGAGGGTGG + Intronic
928115211 2:28541230-28541252 CTGTTTGCTAAGAGGGATGGTGG - Intronic
930048917 2:47198814-47198836 GTTCTTAAAAAGAGAGAGGGGGG + Intergenic
930999086 2:57759883-57759905 TTTTTTAGAAAGAGAGAGAGGGG + Intergenic
931167247 2:59761421-59761443 CTTAAAGTAAAGAGAGAGGGAGG + Intergenic
931256462 2:60578184-60578206 CTTTTTATAGAGAGAGAGGTGGG - Intergenic
931528534 2:63186257-63186279 CTTTGTGGAACCAGAGAGGGAGG - Intronic
931959424 2:67465730-67465752 ATTTTAGCACAGAGAGAGGCAGG + Intergenic
933351523 2:81158473-81158495 CTTTGTGGAAAGAGACAGAGTGG - Intergenic
933780277 2:85796209-85796231 CTTTTTACAAAGAGAAACTGAGG - Intergenic
936238540 2:110767387-110767409 TTCCTTGCAAAGAGAGGGGGAGG + Intronic
937711589 2:124985792-124985814 CAGTTTGCACAGAGAGAGAGAGG - Intergenic
938717163 2:134031205-134031227 ATTTTTGCAATGTGAGAGTGAGG - Intergenic
939472681 2:142644538-142644560 CCTTTTCCAAAGAGAGAGGTAGG + Intergenic
939655165 2:144815745-144815767 CTTTTTGCAGAGAGCAAAGGTGG + Intergenic
939928824 2:148206622-148206644 CTTTTTAAAAAGTGAGAGGTTGG - Intronic
940550176 2:155144208-155144230 CTTTTTACACAGAAAGATGGAGG + Intergenic
941038372 2:160591578-160591600 CTTTGTGAAAAGGGAAAGGGGGG - Intergenic
941159477 2:162019846-162019868 CATTTTGCAAAGAGTAAGGCCGG + Intronic
941249866 2:163148315-163148337 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
941293904 2:163711932-163711954 CTTATTCCAGAGAGCGAGGGAGG - Intronic
942062576 2:172241279-172241301 ATTTTTGGAATGACAGAGGGAGG - Intergenic
942501979 2:176600905-176600927 CGTTTTACAAAGAGAGAAGTAGG + Intergenic
943258611 2:185629494-185629516 CCTTTTGCACAGAGAGAGGAAGG + Intergenic
945017232 2:205531728-205531750 CGTCTTCCAAAGAGAGAGGGAGG + Intronic
945449498 2:209977411-209977433 CCTTTTGGAAAAAGAGAAGGGGG + Intronic
945801553 2:214438009-214438031 CTTTCTGCTAAGTGAGAGAGTGG - Intronic
946013042 2:216581948-216581970 CTTCTTTGAAAGATAGAGGGAGG - Intergenic
946319679 2:218944895-218944917 GTTTTTGGGAAGAGAGAGGCAGG + Intergenic
946326146 2:218985538-218985560 CTGTTTGCAGAGAGTCAGGGAGG - Exonic
946683179 2:222239332-222239354 TTTTTTTCAGAGAGAGAAGGAGG + Intronic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
947413845 2:229872254-229872276 TTTTTTTAAAAGAGAGATGGGGG - Intronic
1169277833 20:4245492-4245514 TTATTTGAAAAGAGAGAGGAAGG + Intronic
1169927235 20:10795609-10795631 CAGTTTGCAAACAAAGAGGGAGG + Intergenic
1169927683 20:10799992-10800014 CTTTGTGCAAATACAGAGGCTGG + Intergenic
1170222275 20:13953185-13953207 CAGTTTGCACAGGGAGAGGGAGG - Intronic
1171002717 20:21430821-21430843 CTTTTTGAAAATAGAGAGCTTGG + Intergenic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1172906277 20:38372169-38372191 CTTTCTGGAAAGAGGGAAGGAGG + Intronic
1172988166 20:39009942-39009964 CTTATTCCAAACAGAGATGGTGG + Intronic
1173250115 20:41359935-41359957 CTTTCTTCAAAGACAGTGGGAGG - Exonic
1173753789 20:45497364-45497386 GTCATGGCAAAGAGAGAGGGTGG + Intergenic
1174471668 20:50766025-50766047 TTTTTTGGAAAGGGAGGGGGTGG + Intergenic
1174486907 20:50866850-50866872 CCTTTTGCAAAGTGAGATGGAGG + Intronic
1174630626 20:51953876-51953898 CTTTGTACAAAGAGAGAGGGAGG - Intergenic
1175443322 20:59005382-59005404 CTTTTTGCAGAGAGATGGGGAGG - Intronic
1178619533 21:34161614-34161636 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1179270671 21:39848130-39848152 CAGTTTGCAAAGAGAGAGGGTGG + Intergenic
1180869542 22:19138453-19138475 CTTCTTGGAGAAAGAGAGGGAGG + Intronic
1181749934 22:24982333-24982355 TTTTTAGCAAAGAGAGAGTAAGG - Intronic
1181847996 22:25728635-25728657 CCTTTTTCAAAGAGTGAAGGTGG - Exonic
1181895963 22:26107676-26107698 GTAATTGGAAAGAGAGAGGGGGG - Intergenic
1183091026 22:35522069-35522091 CTTTTTCTAGAGAGAGAGGGAGG - Intergenic
1183106434 22:35618385-35618407 GGTTTTGCAAAGAAAGAGAGTGG + Intronic
1183113425 22:35669949-35669971 CAGTTTGCACAGAGAGAGAGAGG - Intergenic
1183519068 22:38285967-38285989 ATTTTTGAAAATAGAGATGGAGG + Intergenic
1183909480 22:41067735-41067757 CTTTATGCTAAGAGAGGGGTAGG - Intergenic
1184067397 22:42128496-42128518 CTCTGGGCAAGGAGAGAGGGTGG - Intronic
1184143711 22:42595769-42595791 CTTTTAGCATAGAGTGATGGGGG - Intronic
1185193814 22:49455577-49455599 CTTTATGCAAAGCGTGAGGCAGG + Intronic
949196440 3:1314999-1315021 ATTTTTGTAAAAAGAGAGAGGGG + Intronic
949365724 3:3278464-3278486 CTTTTTCCAAAGAGAGATTGGGG - Intergenic
949811993 3:8016108-8016130 TGTTTTTCACAGAGAGAGGGAGG + Intergenic
950721174 3:14883707-14883729 CCTTTTGCAGGGAGAGAGGGTGG + Intronic
950763744 3:15257839-15257861 CTGTTTTTAAAGAGAAAGGGGGG - Intronic
951345973 3:21547308-21547330 CAGTTTGCACAGGGAGAGGGAGG - Intronic
951649940 3:24940436-24940458 CTTTTTACAACAAGAGAAGGGGG + Intergenic
952391485 3:32884525-32884547 TTTTTTTCAAATAGAGATGGGGG - Intronic
952715173 3:36472665-36472687 GTTTTAGCAAAGAGACTGGGTGG - Intronic
953050509 3:39337898-39337920 CTTTTCTCACAGAGAGAGAGAGG + Intergenic
953207717 3:40846579-40846601 CTTTTTACAAAGATAGATGGTGG + Intergenic
953782617 3:45884861-45884883 TTATTTGCCAAGTGAGAGGGAGG + Intronic
954457846 3:50609635-50609657 TATTTTGCAAGGAGTGAGGGAGG - Intronic
954603427 3:51890628-51890650 CTGATTGCAAAGAGAGAGAGTGG - Intergenic
955534695 3:59910472-59910494 ATTTTTTCAAAGAGAAGGGGGGG - Intronic
956258873 3:67314912-67314934 CTTTTCACAAAGAGAAAGGGGGG + Intergenic
957028154 3:75208837-75208859 CCTTTTGCACAGGGAGAGGGAGG - Intergenic
958899289 3:99866771-99866793 ATTTTTGCAAAGTGAGAGTTTGG + Intronic
959458111 3:106589248-106589270 TATGTTGGAAAGAGAGAGGGTGG + Intergenic
959531013 3:107433538-107433560 CTTTTTGCAGAGATAGGGTGGGG - Intergenic
960945220 3:122961728-122961750 CTCTTTGTAGAGAGAGAGGCAGG - Intronic
962491615 3:135898800-135898822 ATTTCTGCTAAGAGAAAGGGAGG - Intergenic
963817254 3:149845371-149845393 CTTTTTGCTAAAAGAGAGAAAGG + Intronic
963924874 3:150940658-150940680 CTTTTTGCAAAGTTAGAATGGGG + Intronic
964191972 3:154013641-154013663 CTTTTTGCAAAGAAAGGGAGTGG - Intergenic
964304378 3:155325202-155325224 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
964855563 3:161141902-161141924 CAGTTTGCACAGAGAGAGAGAGG - Intronic
965213399 3:165826498-165826520 CTGTTTGCAAAGAGGTGGGGGGG + Intronic
965652191 3:170946390-170946412 CTTTTAGAAATGAGAGAGGTAGG + Intergenic
966523742 3:180899523-180899545 CAGTTTGCACAGGGAGAGGGAGG - Intronic
967360263 3:188622727-188622749 CTTTTTGGAAAAAGAGAGCTGGG + Intronic
970535533 4:17026573-17026595 CCTTTTGCAGTGAGGGAGGGAGG + Intergenic
970587668 4:17530035-17530057 ATTTTTGGAAATAGAGAGAGAGG - Intergenic
972704597 4:41529706-41529728 CTTTTTTGAAAAAGAGAGGAAGG + Intronic
975438293 4:74379920-74379942 CTTCTTACAAAGAGAGAGAGAGG - Intronic
975545600 4:75557239-75557261 CTTTTTGCAGAGAAAGTGGCAGG - Intronic
975756643 4:77578128-77578150 CAGTTTGCACAGGGAGAGGGAGG - Intronic
975840786 4:78471620-78471642 ATTTGAGCAAAGAAAGAGGGTGG - Intronic
975882517 4:78927449-78927471 GTTTATTCAAAGAGAGAGTGGGG + Intronic
976513372 4:85935866-85935888 CTCTTTTCAAAGTCAGAGGGGGG - Intronic
978951015 4:114559516-114559538 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
979104630 4:116668151-116668173 CGGTTTGCACAGGGAGAGGGAGG - Intergenic
979248570 4:118538100-118538122 CTTCATGCAAACAGGGAGGGTGG - Intergenic
979507425 4:121514302-121514324 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
980463499 4:133147807-133147829 TTTTATGCAAAGAGATAGGAAGG - Intergenic
980836942 4:138206267-138206289 CCTTTAGCTGAGAGAGAGGGAGG - Intronic
980959844 4:139464102-139464124 CTTTTTGTAGAGACAGTGGGGGG - Intronic
981230562 4:142349464-142349486 CTATTTGCTAAGAGAGTGGTTGG - Intronic
981255968 4:142660661-142660683 CAGTTTGCATGGAGAGAGGGAGG - Intronic
981324176 4:143427497-143427519 CGGTTTGCACAGGGAGAGGGAGG + Intronic
981675044 4:147333387-147333409 CTTTCGTCAAAGAGTGAGGGTGG + Intergenic
981932649 4:150207842-150207864 CTTTATTCAAAGAGTGGGGGTGG + Intronic
981964110 4:150580329-150580351 CTTATGGCAACGAGAGAGGAAGG + Intronic
982477620 4:155872637-155872659 CAGTTTGCACAGGGAGAGGGAGG + Intronic
982602655 4:157470895-157470917 CAGGTTGCACAGAGAGAGGGAGG - Intergenic
983070234 4:163259266-163259288 CTTTTTGTTTTGAGAGAGGGGGG + Intergenic
983293346 4:165834335-165834357 ATGTTGGCAGAGAGAGAGGGAGG + Intergenic
983775187 4:171597832-171597854 CCCTGTGCAAAGACAGAGGGAGG + Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984347936 4:178555092-178555114 CTTGTTGCAAAGAGAGATTATGG - Intergenic
985164038 4:187074016-187074038 GTTTTTGCACAGAGAGAGGCTGG + Intergenic
986519070 5:8594489-8594511 CTTTTTGGAAAGAAGGAGTGGGG + Intergenic
989238571 5:39177415-39177437 CATTTTGCAAAATGAGAAGGTGG + Intronic
990854590 5:60249686-60249708 CATTTTGCAAAGATACAGGTAGG + Intronic
990995797 5:61731263-61731285 TTCTTTGCAGAGAGAGAGAGGGG + Intronic
991359853 5:65808209-65808231 TTTTTTGCATAAAGAGAGGAAGG + Intronic
992228967 5:74644501-74644523 ATTTTTAAAAAGAGAGAGAGAGG + Intronic
992306316 5:75442743-75442765 CATTTTGAAAGGAGAGAGGGAGG + Intronic
992359382 5:76020820-76020842 CAATGTGGAAAGAGAGAGGGTGG - Intergenic
994058285 5:95445110-95445132 CTTTTTCCAAAGAGCAAGAGAGG + Intronic
994273250 5:97807142-97807164 CTGTTTGCACAGGGAGAGGGAGG + Intergenic
995392615 5:111655127-111655149 CTTTATGCAACAAGAGAGGAAGG - Intergenic
996559836 5:124816821-124816843 CTTTTTGTAGAGATAGGGGGTGG - Intergenic
996662087 5:126016309-126016331 TTATTTACAAAGAGAGAGAGAGG + Intergenic
997255853 5:132427434-132427456 CTTGTTGCAAAGAGACCAGGAGG - Intronic
998424751 5:142017001-142017023 CTTCTTACACAGAGAGATGGGGG - Intergenic
998982824 5:147723375-147723397 CATTTTTCAAAGAGAATGGGGGG + Intronic
999379924 5:151113495-151113517 ATTTTTAAAAAGAGAGAGAGAGG + Intronic
1000212801 5:159123435-159123457 CTTTTTCCAAAAATAGAGGGGGG - Intergenic
1000402484 5:160845406-160845428 ATTTGTGAAAAGGGAGAGGGTGG + Intronic
1001077251 5:168639264-168639286 CTTGTTGGGAAGAGACAGGGAGG + Intergenic
1001686638 5:173598550-173598572 CTAAGTGGAAAGAGAGAGGGGGG - Intergenic
1003924884 6:10868480-10868502 CTCTTTCAAAAGAGAGAAGGAGG - Intronic
1004156636 6:13174737-13174759 CTATATGGTAAGAGAGAGGGAGG - Intronic
1004765513 6:18722122-18722144 CATTTTGCACAGAAAGAGAGAGG - Intergenic
1005564670 6:27078913-27078935 CTTTCAGCAGAGTGAGAGGGAGG - Intergenic
1007243491 6:40443564-40443586 CCTTTTGCAAAGTGGGAGGAAGG - Intronic
1007353219 6:41290886-41290908 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
1008023207 6:46603561-46603583 CTTTTTCCAAAGAGAGTTTGGGG - Intronic
1008630040 6:53355653-53355675 CTTTTTGCCAAGAGTGAATGTGG + Intergenic
1008840976 6:55904007-55904029 CTTTTTTCAAGGTGGGAGGGGGG + Intergenic
1009476864 6:64103341-64103363 CTTTTTTCAACGTGTGAGGGAGG + Intronic
1009907852 6:69891164-69891186 CAGTTTGCACAGGGAGAGGGAGG + Intronic
1010541786 6:77100223-77100245 CTTTCAGCAAAGTGAGAGAGAGG - Intergenic
1011725124 6:90203375-90203397 TTTTTTGGAGAGAGAGAGAGAGG - Intronic
1012340987 6:98122982-98123004 CATTTTGAAAAGAAAGAGGAAGG - Intergenic
1012583842 6:100899004-100899026 CAATTTGCACAGGGAGAGGGAGG - Intergenic
1012595373 6:101032272-101032294 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1012695163 6:102371816-102371838 ATTTTTTAAAAGAGAGAGGTAGG - Intergenic
1013602177 6:111715251-111715273 TTTTTTTCAAATAGAGACGGGGG + Intronic
1014048309 6:116921098-116921120 GTCTTTTCAAAGACAGAGGGAGG - Intronic
1014137186 6:117903934-117903956 CTTTTTGCTAAGAGAGATGGAGG - Intergenic
1014163227 6:118194731-118194753 CGGTTTGCACAGAGAGAGAGGGG + Intronic
1015008055 6:128308869-128308891 ATATTTGCAAAGAGACAGGTAGG + Intronic
1016282893 6:142439408-142439430 CTTTTTGCAAATAGGGAGTAAGG + Intronic
1016684964 6:146870813-146870835 TTTTTTTCAAAGCGAGAGAGAGG - Intergenic
1020723283 7:11776479-11776501 TTATTTGCTAATAGAGAGGGTGG + Intronic
1022322160 7:29297622-29297644 TAGTTTGCACAGAGAGAGGGCGG + Intronic
1025040872 7:55644483-55644505 CTTTTTGCAAAGAGGAAGAAAGG - Intergenic
1025122385 7:56316231-56316253 GTTTTTGTGAAGAGAGAGAGAGG - Intergenic
1026022675 7:66721978-66722000 TTTTTTGAAAAGACGGAGGGGGG - Intronic
1026650162 7:72209562-72209584 TTGTTTGCAAAGAGAAAGAGAGG - Intronic
1026992962 7:74598043-74598065 TTTTTTGCAGAGACGGAGGGAGG - Intronic
1029031386 7:97471024-97471046 CTTTCTGCAGAAAGAGAGGCTGG + Intergenic
1029116849 7:98242004-98242026 CTGGATGCAAAGAGAGAGAGGGG - Intronic
1029339296 7:99929940-99929962 CCTTTGGGAAAGAGAGACGGAGG - Intergenic
1029552006 7:101241656-101241678 TTTTTTTTAAAGAGACAGGGTGG + Intronic
1030245854 7:107383995-107384017 CAGTTTGCACAGGGAGAGGGAGG - Intronic
1032731309 7:134646158-134646180 CTTATTGCACAGAGGAAGGGAGG - Intergenic
1032951323 7:136917570-136917592 CTTTTTGCAAGGACAGAATGAGG + Intronic
1034208268 7:149338198-149338220 CTTTTTTTAAAGAGAGATTGGGG - Intergenic
1034616075 7:152417936-152417958 TTTTTTTAAAAGAAAGAGGGTGG - Intronic
1036493887 8:9252027-9252049 CTGTTGGCAAAGAGAGGGAGGGG + Intergenic
1038261390 8:25998898-25998920 GTTTATTCAAAGAGAGACGGTGG - Intronic
1040713275 8:50215687-50215709 CTTTTTGAAAGGAGAGAGCTTGG - Intronic
1040758441 8:50808811-50808833 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1043491962 8:80758459-80758481 TTTTTTTCAAAGAAGGAGGGAGG - Intronic
1043541282 8:81265676-81265698 CTTTTGGGAAGGAGAGAAGGAGG - Intergenic
1045555595 8:103211983-103212005 CTTATTGGAAAGAGAAAAGGTGG - Intronic
1045573482 8:103393923-103393945 TTATTTCCAAAGAGAGAGGAGGG - Intergenic
1045651418 8:104344966-104344988 TTTTTTAAAAAGAGAGATGGGGG + Intronic
1045957360 8:107924383-107924405 TTCTTTGAAAAGAGAGAGGAGGG + Intronic
1046149795 8:110209003-110209025 CATTATCCAGAGAGAGAGGGAGG + Intergenic
1046477797 8:114770532-114770554 TTTTTTGGAAAGACAGAGAGGGG + Intergenic
1048358054 8:133669759-133669781 ATTTTTGTAACGAGTGAGGGAGG + Intergenic
1048452475 8:134545732-134545754 CTTTTGGGACAGAGAAAGGGTGG + Intronic
1049632683 8:143667074-143667096 GTGTTTGCACAGAGGGAGGGAGG - Intergenic
1050413213 9:5387633-5387655 CTTTTAGCACTGAGAGAGGCGGG + Intronic
1051434550 9:17016961-17016983 ATTTTTCGAAAGAGGGAGGGAGG - Intergenic
1051899120 9:22019492-22019514 GTTTTTACAATGAGAGAGGTTGG + Intronic
1052780293 9:32776028-32776050 CTTTTTAAAAAGAGAGACGGGGG - Intergenic
1053136976 9:35657368-35657390 CGTTTGCCAAAGGGAGAGGGAGG + Intergenic
1053676857 9:40439784-40439806 CTTTTCCCAAAGAGAGAGATGGG - Intergenic
1054286862 9:63185123-63185145 CTTTTCCCAAAGAGAGAGATGGG + Intergenic
1054289924 9:63275311-63275333 CTTTTCCCAAAGAGAGAGATGGG - Intergenic
1054387955 9:64579851-64579873 CTTTTCCCAAAGAGAGAGATGGG - Intergenic
1054507765 9:65936518-65936540 CTTTTCCCAAAGAGAGAGATGGG + Intergenic
1054716427 9:68561627-68561649 CTTTTTGTTAAGAGGAAGGGAGG - Intergenic
1054754893 9:68947583-68947605 CTTTTTTAAAAGAGAGAGAGAGG + Intronic
1055113297 9:72580989-72581011 CTTTCTGCAAATATAGAGAGAGG - Intronic
1055406209 9:75976340-75976362 GTTTATGTAAAGAGAGAGAGAGG - Intronic
1055761269 9:79611038-79611060 CTTTTTGCAGGGAGAGGTGGAGG - Intronic
1055770036 9:79707107-79707129 CTTTTTGCAAGGATAGAAGAGGG + Exonic
1056257901 9:84819113-84819135 CATTTCTAAAAGAGAGAGGGAGG - Intronic
1056885703 9:90441801-90441823 CCCTTTGCTAAGAGAGAGGAAGG - Intergenic
1057056096 9:91962043-91962065 GTTTATGGAAAGAGAAAGGGTGG - Intergenic
1057904914 9:98975834-98975856 CTTTTTGCAGAGTGAGAGTGGGG + Intronic
1058009944 9:99965846-99965868 GTGTTTGCAAAGTGTGAGGGGGG - Intronic
1059671256 9:116494495-116494517 CTTTTTGCAAAAAAACAGGAAGG - Intronic
1060176719 9:121502587-121502609 CAGTTTGCAGAGAGAGAGAGAGG - Intergenic
1061015431 9:127978531-127978553 TTTTTTAAAAAGAGAGAGGCCGG + Intronic
1061372698 9:130206766-130206788 CATTTTCCCAAGAGAGAGGCAGG - Intronic
1062038206 9:134392114-134392136 CATTTTGCAGAGGGGGAGGGTGG + Intronic
1186215529 X:7296330-7296352 CTTCTTGCAAAGATAGAGATTGG - Intronic
1189033064 X:37469342-37469364 CTTTTTGCTGTAAGAGAGGGAGG - Intronic
1189326832 X:40117660-40117682 CTCTTTGTAAAGTGAAAGGGTGG + Intronic
1189434613 X:40980752-40980774 GGTGTTGCAAAGAGAGAGGAAGG + Intergenic
1189496899 X:41516742-41516764 CTCTTTTCAAAGAGACAGTGTGG + Intronic
1190633669 X:52413413-52413435 CTTTTTACAGAGAGGGAGGGAGG - Intergenic
1191189918 X:57655787-57655809 TGGTTTGCACAGAGAGAGGGAGG - Intergenic
1191615673 X:63167312-63167334 ATCTCTGCACAGAGAGAGGGCGG - Intergenic
1191620625 X:63211611-63211633 ATCTCTGCACAGAGAGAGGGCGG + Intergenic
1191843434 X:65529067-65529089 CTTCTCGGAAAGAGAGAGGGGGG - Intronic
1191969499 X:66797867-66797889 CTTGTTTCAAAGAGAAGGGGGGG - Intergenic
1192441453 X:71177579-71177601 CTTTTTGGAAACAGGGAGTGGGG + Intergenic
1192474260 X:71426158-71426180 TTTTTTGTAAATAGAGATGGGGG + Intronic
1192552400 X:72064800-72064822 GTTCTATCAAAGAGAGAGGGAGG - Intergenic
1193269767 X:79515500-79515522 CGGTTTTCACAGAGAGAGGGAGG - Intergenic
1193363809 X:80606897-80606919 CAGTTTGCAAAGAGAAAGAGAGG - Intergenic
1193945036 X:87724313-87724335 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1194051890 X:89079501-89079523 CAGTTTGCACAGAGAGAGAGAGG + Intergenic
1194131168 X:90084094-90084116 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1194170120 X:90570943-90570965 TCATTTGCACAGAGAGAGGGTGG + Intergenic
1194912860 X:99668395-99668417 CATTTTACAGAGAGAGAGAGAGG - Intergenic
1195959000 X:110365790-110365812 ATTATTGCAAAGAGTGAGCGAGG + Intronic
1196025025 X:111033115-111033137 CTGTGTGTACAGAGAGAGGGAGG - Intronic
1196746589 X:119076551-119076573 ATTTTTGCAAAGAGAGAGATGGG + Intergenic
1196886608 X:120251487-120251509 CTTCTTGCAAATACAGACGGAGG - Intronic
1196950583 X:120872407-120872429 ATTTTTGGAAAGAGAGAGATGGG - Intergenic
1196951277 X:120877300-120877322 ATTTTTGAAAAGAGAGAGATGGG - Intergenic
1196952101 X:120933650-120933672 ATTTTTGAAAAGAGAGAGATGGG - Intergenic
1196952786 X:120938511-120938533 ATTTTTGAAAAGAGAGAGATGGG - Intergenic
1196953471 X:120943371-120943393 ATTTTTGAAAAGAGAGAGATGGG - Intergenic
1196954156 X:120948232-120948254 ATTTTTGAAAAGAGAGAGATGGG - Intronic
1196954840 X:120953092-120953114 ATTTTTGAAAAGAGAGAGATGGG - Intronic
1196955530 X:120957975-120957997 ATTTTTGAAAAGAGAGAGATGGG - Intronic
1196956210 X:120962836-120962858 ATTTTTGAAAAGAGAGAGATGGG - Intergenic
1196956892 X:120967696-120967718 ATTTTTGAAAAGAGAGAGATGGG - Intergenic
1196957574 X:120972556-120972578 ATTTTTGAAAAGAGAGAGATGGG - Intergenic
1196958256 X:120977416-120977438 ATTTTTGAAAAGAGAGAGATGGG - Intergenic
1196958938 X:120982276-120982298 ATTTTTGAAAAGAGAGAGATGGG - Intergenic
1197062351 X:122196142-122196164 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1197509268 X:127350698-127350720 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1197934727 X:131728752-131728774 GTTTTTTCAAACAGAAAGGGCGG + Intergenic
1197971957 X:132123670-132123692 ATTTTTGGAAAGAGACAGAGAGG - Intronic
1198092730 X:133347726-133347748 CTTTTTGGAAGGAGGGAGGATGG - Intronic
1199169810 X:144722281-144722303 CATTTTGCATGGGGAGAGGGAGG - Intergenic
1199201885 X:145100404-145100426 CATTTGACAGAGAGAGAGGGAGG - Intergenic
1200965529 Y:9032648-9032670 CTTTTTTCAGGGAGAGAAGGGGG - Intergenic