ID: 1088318595

View in Genome Browser
Species Human (GRCh38)
Location 11:108532055-108532077
Sequence GAGAACAAATGGAAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088318595 Original CRISPR GAGAACAAATGGAAGACTGC AGG (reversed) Intronic
901014562 1:6220730-6220752 GTGGAGAAATGGAAAACTGCTGG - Exonic
901439218 1:9267387-9267409 AAGAACAGATGGGAGAGTGCTGG - Exonic
904846558 1:33423042-33423064 GAGTACAGATGGAAGGCGGCTGG + Intronic
908083199 1:60602691-60602713 AAGAGCAAATGTAAGACTACAGG - Intergenic
908194291 1:61733903-61733925 GAGAACAAGGGGAAAACTGAAGG - Intergenic
908325855 1:63022969-63022991 GAGATCAACTGGAATACTACTGG - Intergenic
910054458 1:83014919-83014941 GAAACCAAATGGAAGAATACAGG - Intergenic
910793819 1:91077437-91077459 GAGAACATATGCCAGAATGCAGG - Intergenic
913056548 1:115166943-115166965 GAAAACAAAGGGAAGAATGTTGG + Intergenic
914030904 1:143959178-143959200 CAGTGCAAATGGAAGAATGCGGG + Intronic
914158546 1:145108782-145108804 CAGTGCAAATGGAAGAATGCGGG - Intronic
914926951 1:151897035-151897057 GGCAACAAATGGAACATTGCAGG + Intronic
916180419 1:162078589-162078611 GAGAACAAGTGGGACACTGGAGG - Intronic
916186716 1:162140127-162140149 GAAAACAAAATTAAGACTGCAGG - Intronic
916859518 1:168787922-168787944 AAGAACAAATCAAAGACAGCTGG - Intergenic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
917521926 1:175754854-175754876 GGGAACAAATGTGAGGCTGCAGG + Intergenic
917577180 1:176335846-176335868 AAGAACAAAAGGAAGAATGAAGG - Intergenic
918559701 1:185849834-185849856 GAAAGGAAATGGAAGACTGTTGG - Intronic
918610564 1:186485551-186485573 GAGTTCAAAGGGAAGACTGAGGG + Intergenic
919596249 1:199566557-199566579 GAGAACAACAGGAACAATGCTGG + Intergenic
919811009 1:201408813-201408835 GAGAAGAAAGGGAAGACTTGGGG - Exonic
920466371 1:206190072-206190094 CAGTGCAAATGGAAGAATGCGGG + Intronic
921150432 1:212397627-212397649 GATATCAAATGGAGGACTGATGG + Intronic
922412805 1:225392187-225392209 GAGAAGAAAGGGAAGAGTGGAGG - Intronic
924291498 1:242541471-242541493 GAGAAAAAATGGAGGGATGCAGG - Intergenic
1063931285 10:11030759-11030781 CAGAACAAGTAGAAGATTGCTGG - Intronic
1064653602 10:17534884-17534906 AAGAACAAAGGGAAGATTGGAGG + Intergenic
1064687691 10:17881025-17881047 GAGAAAAAAAGAAAAACTGCAGG - Intronic
1068844888 10:61660848-61660870 GATAACAAATGGAATTTTGCAGG + Intergenic
1070190917 10:74111446-74111468 CAGAACAAAGTGAACACTGCTGG - Intronic
1070491544 10:76981409-76981431 AAGAACAAATGAAAGACAGATGG + Intronic
1071302345 10:84265426-84265448 GAGAACAGAGGGAAGACTTAAGG - Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1072935448 10:99708114-99708136 GAGAATAAATAGAAGATTGGTGG - Intronic
1074468959 10:113709456-113709478 GAGAAGAAAAGAAAGAGTGCAGG - Intronic
1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG + Intergenic
1077757466 11:5048327-5048349 GAGAACAAATGACAGATTACAGG - Intergenic
1078795131 11:14584731-14584753 GAGATCTAAAGGAAAACTGCGGG - Intronic
1079117928 11:17652331-17652353 GGGAATAAATGAATGACTGCTGG - Intergenic
1079129553 11:17739339-17739361 GAGAATAAATGTGAGACTCCAGG + Intronic
1079983728 11:27178463-27178485 CAGAGAAAATGGAAGACTTCAGG - Intergenic
1083555424 11:63622341-63622363 GTCACCAAATGAAAGACTGCTGG - Intergenic
1085258026 11:75187979-75188001 AAGAACAAATGGAACACTGCAGG + Intronic
1086543783 11:87944464-87944486 GACCAAAAATGGAAGACTACAGG - Intergenic
1086980699 11:93195340-93195362 GAGGAGACATGGAAGACTCCAGG - Intronic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1089510566 11:118994316-118994338 GAAAAAAAAAGGAAGACAGCTGG + Intergenic
1089716494 11:120365340-120365362 GAATGCAAATGAAAGACTGCTGG + Intronic
1090422852 11:126587507-126587529 GAGAGCACAGTGAAGACTGCAGG - Intronic
1091677085 12:2499422-2499444 GAGAACCCGTGGAAGTCTGCTGG + Intronic
1092864263 12:12746124-12746146 GAGAACAAAAGGAAGGGTGGTGG + Intronic
1093830498 12:23751009-23751031 AAGAACTAAAGAAAGACTGCTGG - Intronic
1094443244 12:30502329-30502351 GAGAACAAATACAAGATTTCTGG - Intergenic
1094661767 12:32476179-32476201 GACAACAGCTAGAAGACTGCTGG - Intronic
1096483650 12:51960767-51960789 GAAAACAAATGGGAGATTGAAGG - Intronic
1097078772 12:56413981-56414003 GAGGACATATGGAAGACACCAGG + Intergenic
1098443726 12:70545175-70545197 GGGAACAACTGGAAGAATGGAGG + Intronic
1098881542 12:75922265-75922287 GAGAGGAAATGGAAGAATGGTGG - Intergenic
1100146232 12:91681190-91681212 GAGAACAACTAGAATATTGCTGG - Intergenic
1101293360 12:103394844-103394866 GAGAACAAGGGGAAGACAGGTGG + Intronic
1101298607 12:103453430-103453452 AAGAATAAATGAAAGACTGAAGG - Intronic
1101536654 12:105623957-105623979 GAGAACAAACAGAGGACAGCTGG - Intergenic
1103307383 12:119976196-119976218 GAGAACAATTACAATACTGCTGG - Intergenic
1105425783 13:20293641-20293663 GAGAACAGATGAGTGACTGCGGG - Intergenic
1106016053 13:25870105-25870127 CAGAACAATTGGAGGACAGCCGG - Intronic
1106698631 13:32205624-32205646 AAGCACATATGGAAGATTGCTGG - Intronic
1107328579 13:39272177-39272199 GTGAAAAGATGGAAGGCTGCTGG + Intergenic
1108706546 13:52993693-52993715 GAGAACAAAAGTACTACTGCAGG - Intergenic
1109733303 13:66446327-66446349 TAAAAAAAATGGAAGACAGCTGG + Intronic
1110184334 13:72655894-72655916 GAGAACAGAAGGAAGAATGTAGG + Intergenic
1110299128 13:73905222-73905244 GAGAAGCAATGGTAAACTGCAGG - Intronic
1110620448 13:77588426-77588448 GAGGACAAATAGAGAACTGCTGG + Intronic
1111721176 13:91947018-91947040 GTGAACAGATGGAATGCTGCTGG - Intronic
1111982478 13:95031423-95031445 GAGAACAGAAGGTAGATTGCTGG - Intronic
1115977315 14:39011403-39011425 GGACACAAATGGAAGACTCCAGG - Intergenic
1116099743 14:40418228-40418250 GAGAACAAAAGGAAGACGTTGGG - Intergenic
1116585125 14:46693951-46693973 GGGAACAAAAGGAAGACTACTGG - Intergenic
1116752925 14:48909700-48909722 GGGAACTAATGGAAAACTACTGG + Intergenic
1117684272 14:58237506-58237528 GAGAAAAAAAGGAAAACTACAGG + Intronic
1117872061 14:60211370-60211392 GAGAACAAAGGTAAGATTGCTGG - Intergenic
1119333153 14:73810448-73810470 GAGAAGAAACCGAAGACTGTTGG - Intergenic
1120488742 14:85149214-85149236 GATAACAAATGGCTGTCTGCTGG - Intergenic
1121786596 14:96666180-96666202 GAGAGCAAAGGGAAGACGGAGGG - Intergenic
1122505533 14:102229495-102229517 TGGAACAAATGGAAGAGTGCCGG - Exonic
1122669029 14:103355742-103355764 CAGGTCACATGGAAGACTGCTGG - Intergenic
1123900097 15:24867856-24867878 GCAAACAAATGGAAGACAGGAGG - Intronic
1125126518 15:36229379-36229401 GAAAAAAAATGGAAGTGTGCAGG - Intergenic
1126832938 15:52627631-52627653 GAGAAAAAATGTCAGACTGAAGG + Intronic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1129366307 15:75057447-75057469 GGGAACAAATGGAGGAGTGAAGG + Intronic
1129958117 15:79657848-79657870 GAGGACAAAAGGAAGACTGCAGG - Intergenic
1129979608 15:79855707-79855729 GAGAACACATGGAAGAAAGAGGG - Intronic
1133155375 16:3871131-3871153 AGAAACAAATGGAATACTGCAGG + Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1133791743 16:9014290-9014312 GAGAAAAACTGTAAGCCTGCAGG + Intergenic
1134182800 16:12061345-12061367 GAGAACAAATGCAAGAGGTCTGG + Intronic
1137861659 16:51852851-51852873 AAGAATAAATGGCAGACTGCTGG + Intergenic
1138158694 16:54731783-54731805 GAGAGCAAAAGGAGGACTGGAGG - Intergenic
1138231968 16:55344553-55344575 CAGAACAGATGGAAGATTCCTGG - Intergenic
1138878705 16:60984161-60984183 GAGAACAAAATGAAAACTGCAGG + Intergenic
1139170798 16:64627643-64627665 GAGAACTCCTGGAAGTCTGCCGG - Intergenic
1140524140 16:75608228-75608250 GAAAACAATTGGAAGCCTTCAGG - Exonic
1141104663 16:81223610-81223632 GATAACAAATGCAAATCTGCAGG + Intergenic
1141858629 16:86701553-86701575 GAGACCATATGGAAGACCGGTGG + Intergenic
1142310344 16:89308765-89308787 GAATACAAATGGAATACCGCAGG + Intronic
1142653554 17:1373783-1373805 CAGAACAAATGGAAGGTTTCTGG - Intronic
1144413258 17:15021678-15021700 GAAAAAAAATGCAAGTCTGCAGG - Intergenic
1144839940 17:18179648-18179670 AAGAATAGATGGAAGACAGCAGG + Exonic
1151516794 17:74601672-74601694 GACAACAAAAGAAATACTGCCGG + Intergenic
1153533690 18:6077728-6077750 AAAAAAAAATGGAAGACTCCTGG + Intronic
1153666573 18:7371864-7371886 AAGATCAAATGCAAGAATGCAGG + Intergenic
1155102276 18:22623326-22623348 GAGAACACATGGACAACTGGAGG - Intergenic
1155335211 18:24756560-24756582 GAGAACAAATGGATGGCTCAGGG - Intergenic
1155424718 18:25695056-25695078 GAGAACAAATGGAGGCCCACAGG - Intergenic
1156103480 18:33627173-33627195 GAGGACAAATGGACAACTGAAGG + Intronic
1156865814 18:41887589-41887611 GAGTACAAATTGAGCACTGCTGG + Intergenic
1157004894 18:43570840-43570862 GAAAGCAAGTGGAAGACTACGGG - Intergenic
1158682250 18:59579246-59579268 GAAAACAAAAGAAATACTGCAGG + Intronic
1159263546 18:66048635-66048657 TTGAACAAATGGAAAAGTGCTGG - Intergenic
1159600204 18:70422008-70422030 GAGATCAAATGACAGACAGCTGG + Intergenic
1160613547 18:80107756-80107778 GAGGATCAATGGGAGACTGCAGG + Intergenic
1164159123 19:22615263-22615285 AGGAACAGAAGGAAGACTGCTGG + Intergenic
1164816244 19:31205622-31205644 GGAAACAAATGGCAGACTCCAGG - Intergenic
1164895805 19:31876687-31876709 GTGGACAGATGGAAGACTCCGGG + Intergenic
1165999855 19:39871503-39871525 GAGAACAAATCTAAGGCCGCGGG + Intronic
1168687930 19:58359396-58359418 GAGTAAAAATGGAAGAATGGGGG + Intronic
925461842 2:4069953-4069975 GAGAACAGATTGAAGGCTGTGGG - Intergenic
927415695 2:22878287-22878309 AAGAACAATTGGCAGGCTGCAGG + Intergenic
927837963 2:26416239-26416261 GAAAAAAAATGAAAAACTGCAGG - Intronic
929831760 2:45352693-45352715 GACCACAATTGGAAGCCTGCTGG + Intergenic
931257983 2:60590595-60590617 GAGAATAAATGGGACAGTGCAGG - Intergenic
932137146 2:69241579-69241601 GAGAACAAACATAAGAGTGCAGG + Intronic
937183297 2:120014904-120014926 GAGCGCAATTGGAAGAGTGCAGG + Intronic
939039285 2:137168514-137168536 CAGCACAAATGAAAGACTGAAGG + Intronic
942070691 2:172312919-172312941 CAGAACAAAGGGCAGACTTCAGG + Intergenic
943201948 2:184838816-184838838 AAGAACAAATAGAGCACTGCCGG - Intronic
945796156 2:214366714-214366736 GAAAACAATTGGAACACAGCAGG + Intronic
946000309 2:216476737-216476759 GTGAAGAAATGGAAGTGTGCAGG + Intronic
947374285 2:229480064-229480086 CAGAAAAAATAGAAGAATGCAGG + Intronic
948285632 2:236782600-236782622 GAGACGAAATGGAATGCTGCTGG + Intergenic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1172071634 20:32261630-32261652 GAGACCAAGGGGAAGGCTGCTGG - Intergenic
1175118101 20:56697765-56697787 GACCACAAATGGCAGACCGCAGG + Intergenic
1175988238 20:62774959-62774981 GGGACCAAGTGGAAGACTGGCGG - Intergenic
1177124308 21:17177349-17177371 GAAAACATATGGAAGACAGGAGG + Intergenic
1179089739 21:38253447-38253469 GAGAACAAACTGGAGACAGCTGG + Intronic
1179412230 21:41170687-41170709 GAGAATAAATGCATGACTCCTGG - Intronic
1180954375 22:19735094-19735116 GAGAACATGGGGAGGACTGCAGG - Intergenic
1181537191 22:23552570-23552592 GAGAATGAATGGAAGATTGATGG - Intergenic
1182415006 22:30215923-30215945 GGGAATAAATGAAAGACTGGAGG - Intergenic
1182811147 22:33117838-33117860 GTGAACAAATGGCAAAATGCTGG + Intergenic
1184478478 22:44734331-44734353 GTGAATGAATGGAAGACAGCAGG - Intronic
950469907 3:13178058-13178080 GAGAACAAATGCAAGAGAACAGG - Intergenic
952964266 3:38611323-38611345 GGGAACAAAGTGAAGACTGATGG + Intronic
953699519 3:45185031-45185053 GAGAATAAATGGAAGCGTGGAGG + Intergenic
954161084 3:48722982-48723004 AACAATAAATGGAAGTCTGCTGG - Intronic
955166936 3:56524091-56524113 GGGAACAAATGGACATCTGCTGG + Intergenic
955212480 3:56954878-56954900 GAGGACTAATGGAGGTCTGCAGG + Intronic
956517149 3:70061971-70061993 GAGAACGAATGGGAGTCTGGGGG - Intergenic
957401249 3:79716710-79716732 CACAAGAAATGGAAGACGGCAGG + Intronic
958795013 3:98698086-98698108 GGGAACAATTAGAAAACTGCAGG + Intergenic
959859035 3:111195759-111195781 GAGAACAGATGGAAGGCACCAGG - Intronic
961933543 3:130559074-130559096 GAGAACAAATGTAAAGCTGTTGG + Intergenic
962379430 3:134885672-134885694 GAGAACATTTGGAAAACTTCTGG + Intronic
964237605 3:154551583-154551605 GAGACTAAATGGAAAACTCCAGG + Intergenic
965686075 3:171304112-171304134 GAGTACATATGGATGTCTGCAGG + Intronic
966114330 3:176443896-176443918 AAAAACAAATGGAAGTCTACTGG + Intergenic
967500523 3:190192166-190192188 GGGAACAAAGGGATGACTCCAGG - Intergenic
967574827 3:191077344-191077366 GAGAGAAATTAGAAGACTGCTGG - Intergenic
967767218 3:193294148-193294170 GTGAATAAATGGAAGACAGATGG + Intronic
967841225 3:194006257-194006279 GAGACCAAAGGGAAGGCTGGAGG + Intergenic
970759336 4:19465324-19465346 GAAAACAAAGGGAAGGCTTCAGG - Intergenic
971190497 4:24424043-24424065 GAGAAGAAATGGAAAACTTGGGG + Intergenic
972020140 4:34302545-34302567 GAAAAATAATGGAAGAATGCAGG + Intergenic
973073533 4:45895129-45895151 GAGAACATTTTGAAGATTGCTGG - Intergenic
973333506 4:48933395-48933417 GTGAACAAATCGAAGCTTGCTGG - Intergenic
973726618 4:53783352-53783374 TGGAACAAGTGGAAGACTGCAGG + Intronic
977795362 4:101158353-101158375 GATCACAAATGGAAGCCTGGTGG + Intronic
978303943 4:107301518-107301540 GAGAAGAAATGGAAGCCTAGAGG + Intergenic
979159031 4:117435158-117435180 GAGAACAAAAGGAACAGTTCAGG - Intergenic
979786573 4:124722348-124722370 GAGAGCAAGAGGAAGACTGAGGG - Intergenic
981085261 4:140676743-140676765 GACAACAAATGAAAGAATGCAGG + Intronic
981638897 4:146912748-146912770 AAGAACAGATGGGAGACTGGTGG + Intronic
982079557 4:151775523-151775545 AAGAACAAAGGGAAGAATGGTGG + Intergenic
982438263 4:155402253-155402275 GAGAAAAAATGGGAGAAAGCAGG + Intergenic
982568226 4:157014371-157014393 GAGAACAAAAAGATGACTTCTGG - Intergenic
984088342 4:175339826-175339848 GACAAAATAGGGAAGACTGCAGG - Intergenic
984675119 4:182538668-182538690 TAGAGCAAATTGGAGACTGCAGG + Intronic
988273625 5:29051607-29051629 GAGAAGAAAAGGATGACTGCTGG + Intergenic
992632727 5:78697612-78697634 GAGAAAAAATGGAAGGCAGCAGG - Intronic
995084385 5:108090301-108090323 GAGAAAATGTGGAAGACTGAGGG - Intronic
998228450 5:140344628-140344650 GAGAGGAAATGAAAGACTGTGGG - Intronic
998253274 5:140566832-140566854 GATAGCAAATGGATGACAGCTGG - Exonic
998641808 5:144020294-144020316 GAGAGAAAAGGGAAGACTTCAGG + Intergenic
999367148 5:151030506-151030528 GAGTACAAATGAAAGCCTTCTGG + Exonic
999544178 5:152608670-152608692 GAGAACAAATGGAACGTGGCAGG + Intergenic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1004693882 6:18015975-18015997 GAGAAAAAATGGGAGAAAGCTGG - Intergenic
1005020994 6:21418634-21418656 GAGAACAAGTGGAGGTCAGCTGG - Intergenic
1005882080 6:30069548-30069570 GAGAACAAAAGGAAGACACTGGG - Exonic
1007275351 6:40669295-40669317 GAGAAATAATGGGAGATTGCAGG - Intergenic
1009058175 6:58364451-58364473 GAGAAGAAATGGAAAGCTGAGGG + Intergenic
1009232650 6:61082662-61082684 GAGAAGAAATGGAAAGCTGAGGG - Intergenic
1009356062 6:62747118-62747140 GAGAGCAATTGGAAGACTTTTGG - Intergenic
1010815415 6:80352466-80352488 GAGAAAGAATGGAACACTTCAGG - Intergenic
1011937453 6:92798989-92799011 GAGAAAAAATGAAAGAGTGGAGG + Intergenic
1013301304 6:108807522-108807544 GAGAAAAATTGAAAGACTGAAGG - Intergenic
1013957715 6:115859888-115859910 GAGAACACATGGACAACTGGAGG + Intergenic
1014054115 6:116993409-116993431 GAGATAAAATGTAAGACTGTGGG + Intergenic
1014857608 6:126421256-126421278 GAGTTTAAAAGGAAGACTGCAGG - Intergenic
1015481600 6:133717386-133717408 GAGAACACATGGAAACCTGGAGG + Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1017367601 6:153663208-153663230 GAGAACAAAGGAGAGACTGGTGG - Intergenic
1017837323 6:158190264-158190286 CTGAGCAAATGGAAGACTGGAGG - Intronic
1022820880 7:33959599-33959621 GAGAGCAAATGCAAGAATGGTGG + Intronic
1023433838 7:40121758-40121780 GACAACAAATTCAAGACTGTAGG - Intergenic
1024477255 7:49826246-49826268 GACTAAAAATGGAAGACTTCTGG - Intronic
1026054584 7:66973404-66973426 GAGAAGAAATGGAAGAATCGTGG + Intergenic
1026202005 7:68222477-68222499 GAGAAGAATTGGCAGACAGCTGG + Intergenic
1026332681 7:69366428-69366450 GAGAACAAATTGAAGGTTGATGG + Intergenic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1026722559 7:72844637-72844659 GAGAAGAAATGGAAGAATCGTGG - Intergenic
1028492461 7:91427328-91427350 GAGCACTGATGGAAGACTGCTGG - Intergenic
1032869125 7:135962580-135962602 GAGAAAAAATTGAAAACAGCTGG - Intronic
1033291775 7:140091238-140091260 GAGAGCACCTGGAAGACTACGGG + Intronic
1034741168 7:153474833-153474855 GGCAAGAAATGGAAGACTGTGGG - Intergenic
1036111218 8:5905051-5905073 GAGAACAGAGGCAAGTCTGCCGG + Intergenic
1038100282 8:24365751-24365773 GAGAACAAATGGACATATGCAGG - Intergenic
1038267095 8:26045924-26045946 GAGAACATATGAAAGAAGGCGGG + Intergenic
1038835584 8:31117664-31117686 GAGAAGAAATGGATGACCGGTGG - Intronic
1041251609 8:55940021-55940043 TAGACCAATTGGAAGCCTGCAGG + Intronic
1042203732 8:66307210-66307232 GGAAACAAGTGGAAGTCTGCTGG + Intergenic
1042363232 8:67906556-67906578 GAGAATAAATTTAAGAATGCAGG + Intergenic
1043356659 8:79421433-79421455 GAGTGCAAATAGAAAACTGCAGG - Intergenic
1043720095 8:83537148-83537170 GAGAACAAATGACAGATTACTGG - Intergenic
1046319190 8:112548225-112548247 GAGAAGAAATGGAGGAAAGCCGG - Intronic
1046595158 8:116252609-116252631 AAGAACAACTGGAAGAGTGGAGG + Intergenic
1046732652 8:117741971-117741993 AGGAAAGAATGGAAGACTGCAGG - Intergenic
1047087090 8:121529815-121529837 GAGAACGACTGAAAGACTCCTGG + Intergenic
1047917557 8:129598865-129598887 GAGAACACATGGATGCATGCAGG - Intergenic
1048641003 8:136361474-136361496 ATGAACAAATTGAAGACTGCAGG - Intergenic
1050239009 9:3614239-3614261 GAGAACACATGGCACACTGGGGG - Intergenic
1050259151 9:3822951-3822973 AAGAACACATGGAAGACTTCTGG - Intergenic
1050523235 9:6523518-6523540 AAGAAGAAAAGGAAGTCTGCAGG - Intergenic
1050957440 9:11682421-11682443 AAGAAAAAAAGGAAGACTGAGGG + Intergenic
1051331510 9:16029061-16029083 GTGTCCAAATGGAAGACGGCAGG + Intronic
1052476796 9:28970991-28971013 GAGAGGAAAGGGAAGAGTGCAGG + Intergenic
1055094726 9:72400323-72400345 GAGAACACATGGACGTATGCAGG + Intergenic
1055997819 9:82180877-82180899 CAGAACAAAGGGAAGACTTGAGG - Intergenic
1057808127 9:98235575-98235597 GAGAAGGATTGGAAGACTTCAGG - Intronic
1059012516 9:110477440-110477462 GAGAAAAAATGTAACCCTGCTGG + Intronic
1059733701 9:117081217-117081239 GAGAACAGCTGAGAGACTGCAGG - Intronic
1059906213 9:118989819-118989841 CAGAACAAAAAGAAGACTGATGG + Intergenic
1060651091 9:125327897-125327919 GAGAACAGATGAAAGAAAGCTGG - Intronic
1060942089 9:127548583-127548605 AAGTACAAATGCAAGACAGCGGG - Intronic
1061527744 9:131181274-131181296 GGGAACAAGAGGAAGAATGCTGG + Intronic
1186969388 X:14823836-14823858 TAGAACAAATGTATGACTGGGGG - Intergenic
1187071100 X:15889227-15889249 AAGAACAAATGGAGGAGGGCAGG + Intergenic
1189655380 X:43239469-43239491 GAGAGATAATGGAAGTCTGCAGG + Intergenic
1191755137 X:64584570-64584592 GAGAACAAATGAAATGCTGATGG - Intergenic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1191892327 X:65956798-65956820 GAGGACACATGGATGACTGGTGG - Intergenic
1192171680 X:68859507-68859529 GATAACAAATGGAAGTCTCTTGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194922483 X:99783315-99783337 GAGATCAAGTGGAAGGCTGCGGG - Intergenic
1195856876 X:109341426-109341448 GAATACAATTTGAAGACTGCTGG + Intergenic
1195966185 X:110432236-110432258 GAGATGAAATGGAAGAGAGCTGG - Intronic
1196774655 X:119327238-119327260 TAGAGCAGATGAAAGACTGCTGG - Intergenic
1197018328 X:121655036-121655058 GGAAACAAATGGAATACTGGGGG - Intergenic
1197757018 X:130002589-130002611 GAGAATGAATGGGAGACTGAGGG + Intronic
1197905734 X:131423605-131423627 GAGAAAACAAGGAAGACTTCAGG + Intergenic
1198412587 X:136386682-136386704 GAGATTAAATGGGAGAATGCAGG + Intronic
1198844179 X:140892068-140892090 GAGAACAGCTGGAAGATGGCAGG + Intergenic
1199205546 X:145144953-145144975 GAGAACAAATGCGTGCCTGCAGG + Intergenic
1201897701 Y:19010319-19010341 GAGAACAAATGGTAGAAAACAGG + Intergenic