ID: 1088321604

View in Genome Browser
Species Human (GRCh38)
Location 11:108560015-108560037
Sequence GTGTGGGTAGGGTGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1669
Summary {0: 1, 1: 2, 2: 22, 3: 208, 4: 1436}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088321604 Original CRISPR GTGTGGGTAGGGTGGGAAGG AGG (reversed) Intronic
900156271 1:1204499-1204521 GTGGGGGGAGGGAGGGAGGGAGG + Intronic
900183536 1:1322721-1322743 GGATGGGCAGGGTGGGTAGGGGG + Intronic
900292500 1:1929405-1929427 GTGAGGGTAGGGAGGGAGCGAGG + Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900512490 1:3067238-3067260 GTGTGGGGAGGGTGGGTAAAGGG + Intergenic
900681722 1:3920268-3920290 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
901059416 1:6465277-6465299 GGGAGGGCAGGGTGGGAAGCAGG - Intronic
901061835 1:6475270-6475292 GGGTGGGGAGGGTGGGGAGGAGG - Intronic
901395582 1:8978725-8978747 CTGAGGGTGGCGTGGGAAGGTGG + Intergenic
901436532 1:9250368-9250390 GTGTGTGTGGGGTGGGGAGTGGG - Intronic
901436557 1:9250444-9250466 GTGTGTGTAGGGTGGGGAGTGGG - Intronic
901436569 1:9250482-9250504 GTGTGTGTGGGGTGGGGAGTGGG - Intronic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901810076 1:11762397-11762419 GTGGGGGTGGAGTGGGAGGGGGG + Intronic
902091541 1:13907507-13907529 GTGTTGGGTGGGTGGGAATGGGG + Intergenic
902352175 1:15864864-15864886 AAGGGGGTAGGGTGGGGAGGTGG + Intronic
902396021 1:16132850-16132872 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902396059 1:16132979-16133001 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902448151 1:16480335-16480357 GTGTGGCTGGGGTGGCAGGGTGG - Intergenic
902776686 1:18679346-18679368 GCGTGGGGAGGGGGAGAAGGAGG + Intronic
902909615 1:19585818-19585840 GTGGGGCTAGGGAGGGAATGGGG + Intergenic
902919245 1:19656643-19656665 GTGGGGAATGGGTGGGAAGGTGG + Intronic
902944977 1:19829051-19829073 GGGTGGGGAGGGTGGTCAGGAGG - Intergenic
903167626 1:21531893-21531915 GTGTGTGTAGGGTGGCGGGGAGG - Intronic
903226630 1:21897445-21897467 GTAGGGGTGGGGAGGGAAGGGGG - Intronic
903273895 1:22208824-22208846 GTGTGGGCAGGGAGCGACGGTGG + Intergenic
903274322 1:22210994-22211016 TGGTGGGTGGGCTGGGAAGGAGG + Intergenic
903443515 1:23405969-23405991 GTAGGGGTAAGGTGAGAAGGAGG - Intronic
903957126 1:27033255-27033277 GTTTGGGTACCGTGGGAGGGAGG + Intergenic
904392380 1:30194628-30194650 GTGTGTCTGGGGTGGGGAGGGGG + Intergenic
904499359 1:30905300-30905322 GTGGGGGTGGGGTGGGGTGGGGG - Intronic
904605650 1:31696317-31696339 GGGTGGGTGGGGGGGGAAGGAGG - Intronic
904823466 1:33259405-33259427 GTGTGGGTAAGGTGGGGACCGGG + Intronic
904831156 1:33307547-33307569 GTGAGGGTGGGGTGGGAGTGGGG - Intronic
904831167 1:33307570-33307592 GTGAGGGTGGGGTGGGAGTGGGG - Intronic
904831301 1:33307906-33307928 GGTTGGGTGGGGTGAGAAGGGGG - Intronic
904880762 1:33695108-33695130 GCAAGGGTAGGATGGGAAGGAGG + Intronic
904881482 1:33700733-33700755 GTGTGGGTTGTGGGGTAAGGAGG - Intronic
904941227 1:34165902-34165924 TTGTGTGTGGGGTGGGGAGGGGG + Intergenic
904953644 1:34264755-34264777 GTGGGGAGAGGGTGGGAATGGGG + Intergenic
904969684 1:34409453-34409475 GTGTGTGTAGGAGGGGCAGGTGG + Intergenic
905032589 1:34897494-34897516 GTGTGGCTGGAGTGGGAGGGAGG + Intronic
905107455 1:35573150-35573172 GATCGGGTAGGGTGGGTAGGGGG - Intergenic
905300408 1:36982813-36982835 GTGGGGGTGGTGGGGGAAGGAGG + Intronic
905338827 1:37264459-37264481 TTGTGGGTGGGGTGGCAATGGGG - Intergenic
905450482 1:38052903-38052925 GTTTGGGTGGGGTGGGAGGAAGG + Intergenic
905654727 1:39678786-39678808 GTCTGGGTAGCAGGGGAAGGAGG - Exonic
905920433 1:41715429-41715451 GCCTGGGGAGGGTGGGAAGATGG + Intronic
905971618 1:42146076-42146098 GTGTGGGTGGGCTGGGAGGGAGG - Intergenic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906156908 1:43619229-43619251 GGGTGGGTGGGGTGGGAGGTGGG + Intronic
906197731 1:43939287-43939309 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
906201810 1:43965426-43965448 GGATGGGTAGGGTGGGAGGAGGG + Intronic
906407844 1:45556241-45556263 GTGTGGGTTGAGTGGGGAGGAGG - Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
907237474 1:53062127-53062149 GGGTGGGGAGTGGGGGAAGGGGG + Intronic
907288334 1:53396375-53396397 GTGTGGCCAGGGTGGGGAGCAGG - Intergenic
907311697 1:53542512-53542534 GTGTGGGGCGGGTGGGGAGATGG + Intronic
908462339 1:64357577-64357599 GTGGGGGTAGGGGTGGGAGGTGG - Intergenic
908682815 1:66681800-66681822 GTGTGGGGAGTGAGGGAGGGAGG - Intronic
908796834 1:67838520-67838542 GTGTGGGAAGGGTGTGATGAGGG - Intergenic
908814959 1:68022369-68022391 GGGTGGGTAGTATGGGGAGGAGG - Intergenic
908914449 1:69109654-69109676 GTGGGGGTAGAGAGGGAAAGAGG - Intergenic
910502411 1:87908034-87908056 GTGGGGGTGGGGTGGGCAGAAGG + Intergenic
910508403 1:87976818-87976840 GTGTGTGTGGTGGGGGAAGGGGG - Intergenic
910523907 1:88155717-88155739 GGGCGGGTAGGTTGGGGAGGGGG - Intergenic
910772526 1:90844377-90844399 CTATGGGGAGGGTAGGAAGGAGG - Intergenic
911086512 1:93982232-93982254 GAGGGGGCAGGGAGGGAAGGGGG - Intergenic
911634480 1:100218920-100218942 GTATGGGTAGAGTGGGGGGGGGG + Intronic
911689623 1:100818208-100818230 AGGGGGGAAGGGTGGGAAGGGGG + Intergenic
911754446 1:101536817-101536839 GTGTGGAAAGGGTGGGAAGACGG + Intergenic
911767917 1:101701651-101701673 GAGTGGGGAGGGGGGGGAGGGGG - Intergenic
912319125 1:108693342-108693364 GTGTGTGTCGGGTGGGGTGGGGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
913221531 1:116664501-116664523 GTGTGGCTAAGGCGGGAAAGAGG - Intronic
913334438 1:117696081-117696103 GTTTGGGAAGGGGGTGAAGGCGG + Intergenic
913688712 1:121257988-121258010 GTTGAGGAAGGGTGGGAAGGTGG + Intronic
913963681 1:143357567-143357589 GGAAGGGGAGGGTGGGAAGGGGG - Intergenic
914058040 1:144183156-144183178 GGAAGGGGAGGGTGGGAAGGGGG - Intergenic
914121105 1:144783209-144783231 GGAAGGGGAGGGTGGGAAGGGGG + Intergenic
914148888 1:145022288-145022310 GTTGAGGAAGGGTGGGAAGGTGG - Intronic
914317075 1:146523413-146523435 GTAGGGGTAGGGTAGGAAGAGGG + Intergenic
914320583 1:146555566-146555588 GTGGGGGTTGGGTGGGGAGTTGG + Intergenic
914497280 1:148209947-148209969 GTAGGGGTAGGGTAGGAAGAGGG - Intergenic
914827293 1:151145475-151145497 TTGGGGGTTGGGTGGGAAGGAGG - Intronic
915486574 1:156225445-156225467 GTGGGGAAAGGGTGGGAGGGGGG - Intronic
915508414 1:156371965-156371987 GTGGGGGAAGGTTGGGGAGGCGG + Intronic
915571291 1:156746699-156746721 GGGTGGGTCGTGGGGGAAGGTGG + Intronic
915681574 1:157586478-157586500 GTGGGGGTCGGGTGTGAAGGAGG + Intronic
915713134 1:157920272-157920294 GTGGTGGGAGAGTGGGAAGGGGG - Intergenic
915848924 1:159299979-159300001 GTGGGGGTGGGCTGGGAAGATGG + Intronic
915970889 1:160354370-160354392 GAGGGGGTAGTGTGGGAAAGCGG - Intronic
916146038 1:161740160-161740182 GGGTGGGGAGGGTCGGAAGTTGG + Intergenic
916296435 1:163225581-163225603 GTGTGTGTGGGGTGGGTAGGGGG - Intronic
916437569 1:164791081-164791103 GTGTGGGTAGGGTGGGAAAGAGG - Intronic
916437908 1:164793591-164793613 TTGTGGGGAGGATGGGATGGGGG - Intronic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
916821037 1:168399005-168399027 GTCTGAGTGGGATGGGAAGGTGG + Intergenic
917101362 1:171449156-171449178 GGGTGGGTGGGGTGGGATGTGGG - Intergenic
917137690 1:171803306-171803328 GTGTGTGTGGGGTGGGGTGGGGG + Intronic
917223616 1:172758452-172758474 GTGTGAGTAGAGTTGGGAGGAGG + Intergenic
917309410 1:173663036-173663058 GTGTTGGAAGGGTGGGGAGTTGG - Intronic
917832514 1:178908078-178908100 GAGTGGGGAGGGTGGGAGAGGGG - Intronic
918126778 1:181590765-181590787 GAGTGGGGAGAGTGGGAGGGAGG - Intronic
918146454 1:181760246-181760268 ATGGGGGTAGGGTGGGAAGGAGG - Intronic
919306225 1:195842302-195842324 GTGTGGGAAGAGTGAGAAGGAGG - Intergenic
919813194 1:201421826-201421848 GTGTGTGAAGGGTGGGAGGGAGG - Intronic
920294523 1:204947627-204947649 GGCTGGATAGGGAGGGAAGGAGG - Intronic
920367197 1:205454417-205454439 GTGTGGGGTGCGTGGGATGGGGG + Intronic
920476035 1:206276488-206276510 GTTGAGGAAGGGTGGGAAGGTGG + Intronic
920536048 1:206737245-206737267 GAGTGGGTAGAGTGGGTAGCAGG + Intergenic
920626842 1:207611065-207611087 GTGAGGGTAGGGAGGGGAGGTGG - Intronic
920816371 1:209336933-209336955 GTGGGTGGAGGGAGGGAAGGGGG + Intergenic
921331367 1:214041054-214041076 TTGTGGGGAGGGTGGGAAAGGGG + Exonic
921416485 1:214893754-214893776 GGTTGGGTGGGGTGGGGAGGAGG + Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
922384289 1:225066644-225066666 AGGTGGGAAGGGTGGGAGGGGGG - Intronic
922699815 1:227752404-227752426 GTGTGGGGCGGGTGGGGAAGCGG - Intronic
922889757 1:229052582-229052604 GTGGGGGAAGGGTGGGAGGGGGG + Intergenic
922933491 1:229407673-229407695 GTCTGTGGAGGGAGGGAAGGAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923796623 1:237163349-237163371 GTGGGGGTGGGGGGGGTAGGGGG - Intronic
923802939 1:237228120-237228142 GTGGGGAAAGGGTGGGAAGAGGG - Intronic
923996811 1:239504907-239504929 TGGGGGGAAGGGTGGGAAGGGGG + Intronic
924274500 1:242372007-242372029 GTGTGGGGAGGGTGGTAGGAGGG - Intronic
924424668 1:243940385-243940407 GACTGGGAAGGGAGGGAAGGAGG + Intergenic
924468100 1:244316022-244316044 GTGGGGTTAGGGTGGGAGGTTGG - Intergenic
924845622 1:247767184-247767206 GGGAGGAAAGGGTGGGAAGGGGG - Intergenic
1062818430 10:516817-516839 CAGGGGGTAGGGTGGGAGGGGGG + Intronic
1063666168 10:8061936-8061958 GTCTGGGCAGGGTGGGGAGTGGG + Intronic
1063953811 10:11247606-11247628 GTGTGGCAGGGGTGGGATGGCGG - Intronic
1064503991 10:16009631-16009653 GGGTGGGGAGGGTGGGAGGACGG + Intergenic
1064586306 10:16842808-16842830 GTGTGGGCAGCCTGGGAAGGAGG - Intronic
1064851635 10:19714804-19714826 GTGTGGGCAGGGTGGAGATGGGG + Intronic
1065198136 10:23286563-23286585 GGGAGGGAAGGGTGGGAAGGAGG + Intronic
1065515379 10:26519139-26519161 GTGGGGGTGGGGTGGGGTGGGGG + Intronic
1065957083 10:30703503-30703525 TTTTCTGTAGGGTGGGAAGGGGG - Intergenic
1066598692 10:37080137-37080159 GTGTGTGTTGGGTGGGAAGGTGG + Intergenic
1067005529 10:42657339-42657361 AAGGGGGGAGGGTGGGAAGGGGG - Intergenic
1067043384 10:42970311-42970333 GTGGGGGTTGGGTGGGAAGGAGG + Intergenic
1067083760 10:43227606-43227628 GTGTGGGTAGGGTGGCCAGGAGG + Intronic
1067250885 10:44586460-44586482 GTGTGGCAAGGGAGGGAGGGTGG + Intergenic
1067295984 10:44975428-44975450 GTGGGGGTGGGGGTGGAAGGTGG - Intronic
1067448238 10:46366097-46366119 GTCTCGTTAGGGTGGGCAGGCGG + Intergenic
1067589139 10:47494669-47494691 GTCTCGTTAGGGTGGGCAGGCGG - Intergenic
1067616978 10:47763783-47763805 GTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1067636264 10:48002760-48002782 GTCTCGTTAGGGTGGGCAGGCGG - Intergenic
1067684371 10:48457950-48457972 GTTGGGGTTGGGTGGGAAGGGGG + Intronic
1067800369 10:49354179-49354201 GTGGGGACAGGGTGGGAATGAGG + Intergenic
1067877223 10:50017567-50017589 GTCTCGTTAGGGTGGGCAGGCGG + Intergenic
1067932083 10:50572322-50572344 GTGAGGGAAGGGTGGTAACGAGG + Intronic
1068106975 10:52630773-52630795 GTGAGGGCACAGTGGGAAGGCGG - Intergenic
1068150948 10:53130483-53130505 GTGTGAGTAGAGTGGCAATGAGG + Intergenic
1068153549 10:53166575-53166597 GTGTGGATGGGGCAGGAAGGGGG - Intergenic
1068276013 10:54797796-54797818 GTGTGGGCAGGGGGGGAGCGGGG + Intronic
1068485253 10:57650005-57650027 GGGTGGGGAGTGGGGGAAGGGGG - Intergenic
1068756371 10:60658825-60658847 GGAAGGGTAGGGAGGGAAGGAGG + Intronic
1068896528 10:62209604-62209626 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1069576131 10:69529837-69529859 GCGGGGGAAGGGTGGGAGGGGGG - Intergenic
1069581349 10:69569064-69569086 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1069637760 10:69936062-69936084 GTGAGGGAAGGGAGGGAGGGAGG + Intronic
1069937147 10:71925364-71925386 GAGTGGATGGGGTGTGAAGGAGG + Intergenic
1070128403 10:73640034-73640056 GCCTGGACAGGGTGGGAAGGAGG + Exonic
1070132825 10:73666765-73666787 GTCTCGTTAGGGTGGGCAGGTGG - Intergenic
1070513886 10:77185788-77185810 GTTTGGGCTGGGTGGGAAGTAGG + Intronic
1070658752 10:78289730-78289752 TGGTGGGTGGGATGGGAAGGTGG + Intergenic
1070957160 10:80471747-80471769 GTGGGGGTGGGGTGGGTAGCAGG + Intronic
1071301796 10:84261589-84261611 TTGTGGGGTGAGTGGGAAGGAGG - Intergenic
1071332761 10:84576211-84576233 GGGTGGGGAAGGTGGGTAGGGGG - Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071525728 10:86357123-86357145 GTGTGGGCAGGGTGGACTGGAGG - Intronic
1071544093 10:86514923-86514945 GTGTGGGGTGGGTGGGCCGGAGG - Intronic
1071608854 10:87017309-87017331 GTCTCGTTAGGGTGGGCAGGTGG + Intergenic
1071811792 10:89190121-89190143 GGGGGGAAAGGGTGGGAAGGGGG - Intergenic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1071899891 10:90108747-90108769 GTGGGGGTGGGACGGGAAGGGGG + Intergenic
1072009366 10:91290234-91290256 GTGTGGCCAGAGTGGGAAGCAGG + Intergenic
1072029989 10:91509775-91509797 GAGCGGGTAGGGTGGGAGGAGGG + Intronic
1072305590 10:94103726-94103748 GTGTGGGTAAGGATAGAAGGAGG - Intronic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072862958 10:99025699-99025721 GAGTGGGGAGGGTAGGAAGAGGG + Intronic
1072874809 10:99160974-99160996 GAGTGGCCAGGGTGGGAAGATGG + Intronic
1072933860 10:99693082-99693104 GTGTGAGTAGGGTGGGAGGATGG + Intronic
1072984271 10:100126000-100126022 TTGTGGGCAGAGTGTGAAGGAGG + Intergenic
1073075927 10:100825946-100825968 GTGAGGGAAGAGTGGGGAGGTGG + Intronic
1073091110 10:100940720-100940742 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1073108636 10:101047851-101047873 GTGGGATTGGGGTGGGAAGGGGG - Intergenic
1073144847 10:101273727-101273749 GTGTGGGTGGGTGGGGATGGGGG + Intergenic
1073214188 10:101827581-101827603 ATGGGGGTGAGGTGGGAAGGTGG + Intronic
1073288604 10:102402558-102402580 ATGTGGGCAGGGTGGGTAGCTGG - Intergenic
1073302218 10:102477849-102477871 GTGTGTGTGGGGTGGGGTGGGGG - Intergenic
1073348472 10:102802009-102802031 TGGGGGGAAGGGTGGGAAGGTGG - Intronic
1074099018 10:110338970-110338992 GTGTGAGAGAGGTGGGAAGGAGG + Intergenic
1074568162 10:114600412-114600434 GTGTAGCTAGGGTAAGAAGGTGG - Intronic
1074660204 10:115646938-115646960 GTGGGGGGAGGGGGGGAGGGGGG - Intronic
1074706622 10:116138640-116138662 GTGTGTGTTGGGTGGGTCGGGGG - Intronic
1074779083 10:116787647-116787669 GTGGGGCTAGGGTGGGAGGCGGG + Intergenic
1074921723 10:118021059-118021081 GTGTAGGCAGGGTGGGTTGGGGG - Intronic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075576803 10:123583786-123583808 GCGTCGGAAGGGTGGGAAAGCGG + Intergenic
1075618060 10:123905780-123905802 GTGAGGGTGGGGTGGGAGGCAGG - Intronic
1075680895 10:124330538-124330560 GGGTGGGTGGGGTTGGATGGGGG - Intergenic
1075992050 10:126846529-126846551 GTGTGGGGAGGGTTGGTAGGGGG - Intergenic
1075999873 10:126905787-126905809 GAGGGGGTGGGGTGGGAATGGGG + Intronic
1076288728 10:129327137-129327159 GTGTGTGTAAGGTGGAAGGGAGG + Intergenic
1076408609 10:130230505-130230527 GTGAGGGTAGGGTGGGGTTGGGG + Intergenic
1076430486 10:130398574-130398596 GTGGGGATGGAGTGGGAAGGTGG + Intergenic
1076488551 10:130840396-130840418 GGGATGGTAGGGTGGGGAGGAGG - Intergenic
1076488561 10:130840418-130840440 GGGATGGTAGGGTGGGGAGGAGG - Intergenic
1076488589 10:130840484-130840506 GGGATGGTAGGGTGGGAAAGAGG - Intergenic
1076488604 10:130840528-130840550 GCGATGGTAGGGTGGGGAGGAGG - Intergenic
1076488612 10:130840550-130840572 GGGATGGTAGGGTGGGGAGGAGG - Intergenic
1076583325 10:131529657-131529679 GTGTGAGGAGGGTGAGAAGGCGG - Intergenic
1077037683 11:503170-503192 GGGTGGGTGGGGTGGGGAGAGGG + Exonic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077198490 11:1293401-1293423 GTGTGGGCAGAGAGGGGAGGAGG + Intronic
1077305574 11:1867334-1867356 GTGTGGGTGTGGTGGGTGGGTGG - Intronic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077522364 11:3043822-3043844 GTGGGGGTACTGTGGGCAGGTGG + Intronic
1077673745 11:4180256-4180278 GAGTGAGTAGGGTGGGCAAGAGG - Intergenic
1077700361 11:4435624-4435646 GTGTGGGTAGGTGGGGTAGTTGG + Intergenic
1077868618 11:6243013-6243035 GTGTGGGGAGGGTGGAGAGAGGG - Intronic
1078151295 11:8761667-8761689 GCGTGGGAAGGGTGAGAAGGAGG - Intronic
1078180730 11:9007971-9007993 GCATGGGTAGGGAGGGAATGGGG - Intergenic
1078200987 11:9182750-9182772 GACTGGGAAGGGTGGCAAGGAGG + Intronic
1078329269 11:10405968-10405990 ATCTGGTAAGGGTGGGAAGGGGG + Intronic
1078350131 11:10586162-10586184 GTGTGTGGAGGGTGGGTAGGGGG + Intronic
1078350143 11:10586196-10586218 TTGTGGGTAGGGTGGCAAGTGGG + Intronic
1078488911 11:11751248-11751270 GTGTGGGGTGGGTGGGGAGGGGG - Intergenic
1078707800 11:13761983-13762005 GTGTGGACAGGGTGGAAAGCAGG - Intergenic
1078822898 11:14900127-14900149 TTGTGGGTAGGGGGGGTGGGGGG - Intergenic
1079111419 11:17607293-17607315 GTGTGGGTAGGCTCCGAAGCAGG - Intronic
1079128213 11:17733635-17733657 GGGTGGCTGGGGTGGGAAAGAGG - Intergenic
1079165733 11:18041113-18041135 TTGTGGGCAAGGTGGGGAGGAGG - Exonic
1079336874 11:19577718-19577740 GTGTGGGTTGGGTGGGCATCTGG + Intronic
1079720153 11:23800916-23800938 AAGTGGTTAGGGTTGGAAGGGGG + Intergenic
1080035547 11:27706198-27706220 GAGTGGATAGGGTGAGAGGGAGG + Intronic
1080086469 11:28288662-28288684 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
1080258554 11:30321138-30321160 GTATGGGTAGAGTGGAAAGCTGG - Intergenic
1080321876 11:31019480-31019502 GTGGGGGTGGGGTGGGGAGGTGG + Intronic
1080585399 11:33676990-33677012 ATGAGGAAAGGGTGGGAAGGGGG - Intergenic
1080970145 11:37264412-37264434 GTGAGAGTAGGATGGGAAGATGG + Intergenic
1081091510 11:38872751-38872773 AAGAGGGTAGGGTGGGAGGGAGG - Intergenic
1081211476 11:40340129-40340151 GCTTGGGCAGTGTGGGAAGGGGG - Intronic
1081465632 11:43313755-43313777 GTGTAGGTCGGTTGTGAAGGAGG + Intronic
1081655822 11:44856829-44856851 GTGTAGGGAGGGAGGGAGGGAGG - Intronic
1081733443 11:45387334-45387356 GTGGGTGTAGGGTGGGGTGGGGG + Intergenic
1081825562 11:46048135-46048157 GTGTGGGTAGTTGGGGAATGGGG - Intronic
1081864133 11:46350497-46350519 ATGTGGGTGGGGTGGGGAGGGGG - Intronic
1082076985 11:47981665-47981687 GTGAGGGTGGGGTGGGGAGGGGG - Intronic
1082784018 11:57306908-57306930 GGGGGGGTTGGGTGGGAGGGGGG + Intronic
1083173231 11:60934973-60934995 GTGTGGGTAGTGTGGGGACCGGG + Intronic
1083176406 11:60952552-60952574 GTGGGGCTAGGGCAGGAAGGTGG + Intergenic
1083196526 11:61091826-61091848 GGGTGGGGAGGGGGAGAAGGAGG - Intergenic
1083201938 11:61125923-61125945 GTATGGGCAGGGTGGGACTGAGG - Intronic
1083296174 11:61716850-61716872 GTGTGGGTGGGGGAAGAAGGAGG + Intronic
1083333278 11:61909017-61909039 GTGTGGGTGGGGGCGGAATGAGG - Intronic
1083482930 11:62961242-62961264 GTGAGGACATGGTGGGAAGGCGG + Intronic
1083497450 11:63069598-63069620 AGGGGGATAGGGTGGGAAGGGGG - Intergenic
1083592657 11:63904568-63904590 GTTTGGGAAGGGAGGGAGGGAGG - Intronic
1083929737 11:65834074-65834096 GTATGCGGAGGTTGGGAAGGAGG + Exonic
1083994099 11:66263752-66263774 GTGAGGGTTGGGTGGGAGGTGGG + Intronic
1084144355 11:67256205-67256227 GTGTGTGGAGGGAGGGAGGGAGG + Exonic
1084566346 11:69931066-69931088 GTTAGGGTGGGGTGGGGAGGTGG + Intergenic
1084609185 11:70191342-70191364 GTGTGTGTATGTTGGGATGGGGG + Intergenic
1084647101 11:70464914-70464936 GTGTGGGCGGGGTGGGGCGGTGG + Intergenic
1084941355 11:72615027-72615049 GTCTGCGAAGGGTGGGCAGGAGG - Intronic
1085064145 11:73476455-73476477 GTGGGGGTGGGGTGGGTGGGTGG + Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085245850 11:75099665-75099687 GTGGGGGAAGGGAGGGAGGGAGG + Intergenic
1085245883 11:75099738-75099760 GTGGGGGAAGGGAGGGAGGGAGG + Intergenic
1085479098 11:76806962-76806984 GAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1085743567 11:79096486-79096508 GTGGGGGTGGGGTGGGGTGGGGG - Intronic
1085845560 11:80060685-80060707 GAGTGGGTAACGTGGGGAGGGGG + Intergenic
1086199406 11:84183392-84183414 GTGTGTGTTAGGTGGGGAGGAGG + Intronic
1087585996 11:100122209-100122231 GTGATGGTGGGGTGGGGAGGTGG + Intronic
1087716233 11:101612253-101612275 GGGTGGGTGGGGTGGGAGAGAGG - Intronic
1087821407 11:102716953-102716975 GTGTTGTTGGGGTGGGCAGGAGG + Intronic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088657356 11:112013320-112013342 GTGGGGGTGGGGTGGGGGGGGGG + Intronic
1088796750 11:113271926-113271948 GTGGGGGTAGGGTGGGGAGGTGG - Intronic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089160219 11:116431729-116431751 AGGTGGGTAGGGTGGGATGGGGG - Intergenic
1089238503 11:117053646-117053668 GAGGGGGTAGGGTGGGAGGGGGG - Intronic
1089559438 11:119336427-119336449 GGGTGGGCAGGCAGGGAAGGAGG - Exonic
1089683449 11:120132337-120132359 GTGTGGGCAGGGCGGGACTGTGG - Intronic
1089759966 11:120716008-120716030 ATGTGGGCAGTGGGGGAAGGCGG + Intronic
1090153202 11:124406782-124406804 GTGTGTGTGTGGTGAGAAGGAGG - Intergenic
1090225731 11:125071130-125071152 GTGTGTGTGGGGTGGGGGGGCGG + Intronic
1090363327 11:126187804-126187826 GGCTGGGTAGGGTGGCAGGGTGG + Intergenic
1090378517 11:126308718-126308740 GGGTGGGGAGGGTGGGTAGAGGG - Intronic
1090547687 11:127783165-127783187 CAGTGGGGAGGGTGGGGAGGGGG + Intergenic
1090622989 11:128578129-128578151 GTTTGGGGAGGGTGGGAAGTTGG - Intronic
1090714272 11:129416299-129416321 GTGTGGCTAGGGGGCGGAGGTGG + Intronic
1090931547 11:131302011-131302033 TTGTGGGTTGGGTGGGAAAGGGG + Intergenic
1091078775 11:132646072-132646094 GAGTGGAAAGGGTGGGAGGGGGG + Intronic
1091300504 11:134504160-134504182 GTGTGGGTGGGGTGGGGAAAGGG + Intergenic
1091395610 12:152688-152710 GTGTGTGTGGGGTGGCAGGGAGG - Intronic
1091558085 12:1590903-1590925 GTGTGGGGAGGATGTGAAGGTGG - Intronic
1091658041 12:2360164-2360186 GTGTGTGTGGGGTGGGGGGGTGG - Intronic
1091768373 12:3136594-3136616 GCATGAGTAGGGTTGGAAGGAGG + Intronic
1091781302 12:3216127-3216149 GTGGGGGTGGGGTGGGGATGGGG - Intronic
1091813288 12:3417535-3417557 GTTTGGGGAGGGTGAGAAAGAGG + Intronic
1091916666 12:4275053-4275075 ATTTGGGTGGGGTAGGAAGGGGG + Intronic
1092010965 12:5112239-5112261 GGGTGGAAAGGGTGGGAAGCTGG + Intergenic
1092071850 12:5637711-5637733 GTGGGGCTAGGGAGGAAAGGAGG - Intronic
1092118360 12:6025771-6025793 GTGGCTGCAGGGTGGGAAGGAGG - Intronic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092367037 12:7884878-7884900 CTGAGGGTAGGGTGGGAAAGAGG + Intronic
1092386803 12:8041856-8041878 GTGTGTGTTGGGTGGGATTGGGG - Intronic
1092462580 12:8698702-8698724 TTGTGGGAAGGGGGGGGAGGGGG - Intronic
1093081904 12:14822002-14822024 GTGGGGGTGGGGTGGGGAGTAGG + Intronic
1093692255 12:22121767-22121789 GTGGGGGTGGAGTGGGAAGATGG + Intronic
1093766849 12:22973531-22973553 GTGGGGGTGGGGTGGTGAGGAGG + Intergenic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1095904065 12:47359322-47359344 GAGTGGGGAGGATGGGAAGAGGG - Intergenic
1096036239 12:48473565-48473587 GTGAGGGAAGGGAGGGGAGGAGG + Exonic
1096245151 12:49980612-49980634 GTCTGGGTGGGGTGGAAAAGAGG + Intronic
1096253834 12:50051044-50051066 GCCTGGGTAGGGTGGGAGGGGGG + Intergenic
1096304497 12:50462542-50462564 GTGGGGGTGGGGTGGGGTGGAGG - Intronic
1096368024 12:51045116-51045138 GTGTGTGTAGCGGGGGAAAGGGG + Intergenic
1096429391 12:51530791-51530813 GTGTGTGTGCGGTGGGATGGGGG + Intergenic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096807484 12:54149305-54149327 CTGGGGGTTGGCTGGGAAGGGGG + Intergenic
1097237844 12:57551825-57551847 GTGTGGGTAAGGGTGCAAGGTGG - Intronic
1097246357 12:57609834-57609856 GTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1097338832 12:58414748-58414770 GGGGGGGTGGGGAGGGAAGGAGG + Intergenic
1097769543 12:63566450-63566472 GTTAGGGTGGGGTGGGAATGTGG - Intronic
1097933289 12:65214815-65214837 TGGAGGGTAGGGTGGGGAGGGGG - Intronic
1098323845 12:69279733-69279755 CTGGGGCTAGGGTGGGAATGGGG - Intergenic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1099014754 12:77331000-77331022 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1099808981 12:87556652-87556674 GTATGGGGAAGGTGGGAGGGGGG + Intergenic
1099843220 12:87993684-87993706 GTGTGTGAAGAGTAGGAAGGAGG - Intronic
1100150764 12:91734792-91734814 GTGGAGGTAGGGTTGGAAGCAGG - Intergenic
1100447987 12:94678663-94678685 GGTTGGGTGGGGTGGGATGGGGG + Intergenic
1100921335 12:99491530-99491552 GTGGGTGGAGGGTGGGAAGAGGG - Intronic
1101121007 12:101580082-101580104 TTGTGGGTAGGGGTGGGAGGAGG - Intronic
1101643026 12:106602055-106602077 GTGTGGGCAGTGTGGGCATGAGG + Intronic
1101652477 12:106690066-106690088 GTGTGTGTGTTGTGGGAAGGGGG + Intronic
1101904033 12:108812206-108812228 GAGTGGGTAGGATGGCACGGAGG - Intronic
1102181132 12:110913182-110913204 GTGTGTGTAGGGGGGACAGGGGG + Intronic
1102512670 12:113426127-113426149 GTGAGGGTAGGGGGTGAGGGCGG - Intronic
1102664790 12:114562788-114562810 TTGTGGGAAGTTTGGGAAGGAGG + Intergenic
1102704725 12:114871090-114871112 GTGTGTGTGGGGTGTGAAGTAGG + Intergenic
1102937498 12:116910228-116910250 ACGAGGGGAGGGTGGGAAGGTGG - Intergenic
1103037511 12:117668290-117668312 CCGTGGGTGGGCTGGGAAGGAGG - Intronic
1103238988 12:119397945-119397967 GTGTGGGAGGGGGAGGAAGGGGG + Intronic
1103287627 12:119815851-119815873 TTGGGCGTGGGGTGGGAAGGAGG + Intronic
1103519752 12:121530521-121530543 GGTGGGGTAGGGTGGGAGGGAGG - Intronic
1104348992 12:128028661-128028683 CTGTGGGCAGGGCGGGAATGTGG + Intergenic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104610207 12:130221400-130221422 GTGTGTGTTGGGTGGGGGGGGGG - Intergenic
1104675522 12:130709729-130709751 CGCTGGGTTGGGTGGGAAGGGGG - Intronic
1104809101 12:131609897-131609919 GTGGGGTTTTGGTGGGAAGGCGG + Intergenic
1104899387 12:132180371-132180393 GTGAGGGCACGGTGAGAAGGTGG + Intergenic
1104919767 12:132284788-132284810 TTGTGGGAAGGGTGTGAAGTGGG + Intronic
1105256959 13:18750119-18750141 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1105259640 13:18769494-18769516 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1105262316 13:18788811-18788833 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1105433486 13:20358169-20358191 GAGTGGGGAGGATGAGAAGGGGG - Intergenic
1105765169 13:23552147-23552169 GAGTGGGTAGGAGGGGAAGGAGG + Intergenic
1105885601 13:24638490-24638512 GTCTGGGGAGGGTGGGGAGGGGG - Intergenic
1105930474 13:25047461-25047483 ACGTGGGGAGGGTGGGAGGGTGG + Intergenic
1105985730 13:25564856-25564878 TTGGGGGAAGGGTGGGAGGGAGG - Intronic
1106232359 13:27830398-27830420 CTGGGGTAAGGGTGGGAAGGGGG + Intergenic
1106307980 13:28530508-28530530 GGGTGGGGAGCGTGGGATGGTGG + Intergenic
1106961514 13:35003930-35003952 GTCAGGGTAGGGTGGGAGGAGGG - Intronic
1107484459 13:40813121-40813143 GTGTGGGTGGGGGGGGGGGGGGG - Intergenic
1108601348 13:51997875-51997897 GAGCGGGGAGGGTGGGAAGAAGG + Intronic
1108716648 13:53085915-53085937 GTGTGGGGAGGAGGAGAAGGAGG + Intergenic
1109045222 13:57402166-57402188 GTGTGTGTGGGGTGGGGGGGAGG - Intergenic
1109157491 13:58928752-58928774 GGTTGGGGAGGGTGGGAGGGTGG + Intergenic
1109370837 13:61417104-61417126 GTGTGTGTGGGGTGGGGAGGAGG - Intronic
1109507889 13:63331007-63331029 GGGTGGGAAGGGTGAGAAGGGGG - Intergenic
1109520321 13:63501909-63501931 CTGAGTGTAAGGTGGGAAGGTGG + Intergenic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1109673081 13:65636401-65636423 GTGGGGGTAGGGTGGGGAGGGGG - Intergenic
1109864632 13:68246711-68246733 GTGGGTGGAGGGTGGGAAGAGGG - Intergenic
1110094016 13:71492771-71492793 GTGTGTGTATGGTGTGAGGGAGG + Intronic
1111777226 13:92679879-92679901 GGGTGGGGAGGGTGGGGGGGTGG - Intronic
1111801999 13:92992794-92992816 GTGTGGGGTGGGTGGGGTGGCGG - Intergenic
1111867756 13:93791041-93791063 GTGCGGGTAGGTGGGGTAGGGGG - Intronic
1112151454 13:96769113-96769135 GTGTGTGTTTGGTGGGGAGGTGG - Intronic
1112441419 13:99427097-99427119 CGGAGGGTAGGGTGGGAGGGAGG + Intergenic
1112441427 13:99427114-99427136 GGGAGGGCAGGGTGGGAGGGAGG + Intergenic
1112503161 13:99957377-99957399 GTGTGGGGGGGGTGGTAGGGAGG + Intergenic
1112733966 13:102397116-102397138 GAGTCGGTAGGCTGAGAAGGAGG + Intronic
1112879134 13:104084667-104084689 TTGGGGGAAGGGTGGAAAGGGGG - Intergenic
1113039188 13:106085703-106085725 GTGTGTGGGGGGTGGGGAGGGGG + Intergenic
1113520419 13:110936654-110936676 GTGTGGGCGGGGCGGCAAGGCGG + Intergenic
1113600250 13:111563375-111563397 GTGAGGGGAGGGAGGGAAAGAGG - Intergenic
1113842476 13:113368048-113368070 GTGTGGGGAGGGGGGGTGGGGGG - Intergenic
1114190692 14:20437587-20437609 GGCGGGGTAGGGTGGGAAGTGGG + Intergenic
1114234499 14:20812650-20812672 GTGGGGGTGGGGTGGGATTGGGG - Intergenic
1114519356 14:23323170-23323192 GTGGAGGGAGTGTGGGAAGGAGG + Intronic
1114559730 14:23580997-23581019 GTGGGGGTAGGGGGGTGAGGGGG - Intergenic
1114661993 14:24352621-24352643 ATGTGGGAAGGGTGGGAGCGGGG + Intergenic
1114737873 14:25061630-25061652 GAGTGGGAAGGGTGGGATAGGGG + Intergenic
1114820003 14:26007233-26007255 GGGGGGGAAGGGGGGGAAGGAGG + Intergenic
1115096703 14:29646244-29646266 GTGTGGGATGGGGAGGAAGGAGG + Intronic
1115106554 14:29768978-29769000 GTGGTGGTAGGGTGGGCAGAAGG - Intronic
1115347900 14:32362834-32362856 GTGTGGGGAGGGCTGGAAGTGGG + Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115671538 14:35617625-35617647 GTGTGTGTGGGGTGGGGGGGGGG + Intronic
1115707207 14:36011577-36011599 GTGTGGAAAGGGTGGGAAGGGGG - Intergenic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1115933658 14:38527255-38527277 GGGTGGGAGAGGTGGGAAGGAGG + Intergenic
1116031417 14:39577217-39577239 GTTAGGGTAGGGGGTGAAGGGGG - Intergenic
1116330575 14:43592489-43592511 GTGGGGGGAGGGTGGGAAGTGGG - Intergenic
1116421569 14:44738739-44738761 GTGTGTGTACGGTGTGTAGGAGG - Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116844600 14:49853482-49853504 ATGGGGGTGGGGTGGGAGGGGGG + Intergenic
1117704670 14:58452124-58452146 GTGGGGAAAGGGTGGGAAGCGGG + Intronic
1118084600 14:62400029-62400051 GTGTGCTTAGGGTGGGAGGTTGG + Intergenic
1118199711 14:63660757-63660779 GTGTGGAGAGTTTGGGAAGGAGG - Intergenic
1118351699 14:64976808-64976830 GTGTGGCTGGGGTGGGGATGGGG - Intronic
1118548753 14:66925420-66925442 GGGTGGAGAGGGTGGGTAGGGGG - Intronic
1118610759 14:67537807-67537829 GAGTAGGATGGGTGGGAAGGTGG - Intronic
1119276490 14:73361604-73361626 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1119483834 14:74975729-74975751 GTGTATGTGTGGTGGGAAGGAGG - Intergenic
1119595480 14:75928986-75929008 GGGTGGGGAGGGTGGGCAGGAGG - Intronic
1121245972 14:92460988-92461010 GTGTGGGTAGGGGGAAAAAGAGG + Intronic
1121564936 14:94902136-94902158 GTGTGTGTATGGTGGGGTGGGGG - Intergenic
1121830766 14:97050209-97050231 GTGTAGGCTGGGTGGGAAGGGGG - Intergenic
1122046990 14:99030750-99030772 GGGTGGGCAGGGGAGGAAGGAGG - Intergenic
1122096298 14:99375254-99375276 GTCTGTGGAAGGTGGGAAGGTGG - Intergenic
1122096511 14:99376608-99376630 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1122126329 14:99580465-99580487 GTGAGGGGAGGGGGGGAAGGGGG + Intronic
1122128460 14:99591662-99591684 CGGTGGGGAGGGTGGGGAGGTGG + Intronic
1122307786 14:100776666-100776688 GTGTGGGCCGGGGGGGGAGGTGG - Intergenic
1122371908 14:101233643-101233665 GTGTGGGTGAGGGCGGAAGGTGG - Intergenic
1122572751 14:102718575-102718597 CTGAGGGTTGGGTGGGAGGGTGG + Intronic
1122688056 14:103519215-103519237 GTGTTGGCGGGGTAGGAAGGAGG + Intergenic
1122714520 14:103687016-103687038 GTGTGGCTCTTGTGGGAAGGAGG + Intergenic
1122811654 14:104292255-104292277 GTGTGGGTGGGGGAGGGAGGGGG + Intergenic
1122879470 14:104683603-104683625 GTGTGTGTGTGGTGGGGAGGGGG - Intergenic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1123113130 14:105882235-105882257 GTGTGGCCAGGGTGGAGAGGAGG + Intergenic
1123117096 14:105899713-105899735 GGGTGGGTGGGGTGTGCAGGTGG + Intergenic
1123119171 14:105909022-105909044 GGGTGGGTGGGGTGTGCAGGTGG + Intergenic
1123119730 14:105911103-105911125 GTGTGGCCAGGGTGGAGAGGAGG + Intergenic
1123208754 14:106738666-106738688 GTGTGTGTGGGGGGGGTAGGTGG - Intergenic
1123767398 15:23495161-23495183 GTGGGGGTAGGGTGGGAGGGAGG + Intergenic
1124477204 15:30045297-30045319 TGGCGGTTAGGGTGGGAAGGGGG + Intergenic
1124531010 15:30506475-30506497 GTGTGAGTAGGGTGTATAGGGGG + Intergenic
1124531017 15:30506503-30506525 GTGTGGGTAGGGTGTATATGGGG + Intergenic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1124682090 15:31740430-31740452 GTGGGGGGAGGGTGGGAGGTGGG + Intronic
1124767638 15:32501192-32501214 GTGTGGGTAGGGTGTATATGGGG - Intergenic
1124767645 15:32501220-32501242 GTGTGAGTAGGGTGTATAGGGGG - Intergenic
1124959087 15:34381902-34381924 GTGTGGGTGGGGTGGGCATGAGG - Intronic
1124975713 15:34528123-34528145 GTGTGGGTGGGGTGGGCATGAGG - Intronic
1125148342 15:36500149-36500171 GAGGGGTTGGGGTGGGAAGGAGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125576204 15:40757315-40757337 CTGTGGAGGGGGTGGGAAGGTGG - Intergenic
1125686353 15:41565787-41565809 GTGGGGGTTGGGGGGTAAGGTGG - Intronic
1125687818 15:41573814-41573836 GTGTGAGTATCCTGGGAAGGGGG + Exonic
1127221794 15:56887595-56887617 GTGTGGGGAGGAAGGAAAGGTGG + Intronic
1127313821 15:57776460-57776482 GTGCTGGGAGGGTGGGGAGGAGG + Intronic
1127625923 15:60780067-60780089 GTGGGGAGAGGGTGGGGAGGAGG + Intronic
1127674511 15:61227565-61227587 GTGTGGCTAAGGTGGGGGGGGGG + Intronic
1127707590 15:61562453-61562475 TTGAGGGTTGGGTGGGAGGGAGG + Intergenic
1127761705 15:62146180-62146202 GTGAGGGTAGGGAAGGAGGGTGG - Intergenic
1127979680 15:64025377-64025399 GTGTGGCTGGGGTAGGAAGAAGG - Intronic
1128394870 15:67214467-67214489 GTGTGGGTAGGTGGGAAAGAGGG + Intronic
1128729868 15:70013889-70013911 GTGTGGGCAGGGAGAGAGGGAGG + Intergenic
1128732109 15:70028313-70028335 GGGTGGGTGGGGTGGGGATGGGG + Intergenic
1128762400 15:70226201-70226223 GTGGGGGGAGGTTGGGATGGTGG + Intergenic
1129208884 15:74054089-74054111 GTTGGGGTGGGGTGGGGAGGCGG + Intergenic
1129453207 15:75662336-75662358 GGGTGGGCAGGGCGGGGAGGAGG - Intergenic
1129535944 15:76313814-76313836 GGGTGGGGAGGTAGGGAAGGAGG - Intergenic
1129661903 15:77557453-77557475 GTGTGGGGAGGGTGGAATGCTGG - Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130635871 15:85619335-85619357 GGCTGGCTAGGGAGGGAAGGAGG + Intronic
1130908714 15:88256883-88256905 GTGTGGGGAGGGGAGGGAGGGGG - Intergenic
1131143101 15:89993513-89993535 GAGGGTGTAGGGTGGGAATGAGG - Intergenic
1131184419 15:90262869-90262891 ATGAGGGTAGAGTGGGCAGGAGG + Intronic
1131284151 15:91043675-91043697 ATGTGGTTAGAGTGGGAATGAGG + Intergenic
1131434634 15:92413033-92413055 GGGGGTGTAGGGTGGGGAGGGGG + Intronic
1131643897 15:94321151-94321173 GGCTGGGAAGGGTGGGAATGGGG + Intronic
1131686790 15:94776941-94776963 GTGTGTGTATGGGGGGGAGGGGG - Intergenic
1131768686 15:95710629-95710651 GTGTGGGCTGGGTGTGAAGGAGG - Intergenic
1131770238 15:95729254-95729276 GGGTGGGTGGGGTGGGGTGGTGG - Intergenic
1131957743 15:97755608-97755630 GTGTGTGTTGGGTGGGTGGGTGG - Intergenic
1132094198 15:98969936-98969958 GTGGGGGGAGGGTTGGAGGGAGG + Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132207558 15:99997041-99997063 GTGTGCTCAGGCTGGGAAGGTGG - Intronic
1132270631 15:100520772-100520794 GAGTGGGCAGGGTGGGGAGGAGG + Intronic
1132666564 16:1083597-1083619 GAGTGGGTGGGGTGGGGACGGGG + Intergenic
1132755308 16:1481594-1481616 GGGTGGGTAGGGTGGGGGAGGGG + Intergenic
1133335703 16:5005413-5005435 GTGACGGTGGGGTGGGAATGGGG + Intronic
1133457267 16:5953486-5953508 GGGGGGAAAGGGTGGGAAGGAGG - Intergenic
1133696251 16:8265826-8265848 AAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1134219903 16:12345721-12345743 ATGTGGGCACAGTGGGAAGGTGG + Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134288619 16:12884247-12884269 GGGTGGGAAGGGTGGGAAGGGGG + Intergenic
1135063067 16:19287280-19287302 GTGAGGGTACAGTGAGAAGGCGG - Intronic
1135324639 16:21518702-21518724 GGTTGGGTGGCGTGGGAAGGCGG - Intergenic
1135393852 16:22115949-22115971 GGGTGGGGAGGGAGGGAGGGAGG + Intronic
1135538301 16:23311565-23311587 GTAGGGGTAAGGTGGGATGGTGG - Intronic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1135586131 16:23672501-23672523 GTTTTGGTAGGGAGGGAGGGAGG + Exonic
1135777265 16:25267655-25267677 ATATGGGGAGGGTGGGATGGGGG + Intergenic
1135860510 16:26051752-26051774 GTGTGGGGTGGGGAGGAAGGAGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136043638 16:27599394-27599416 GGGTGGGGAAGGTGGGAATGAGG + Intronic
1136143608 16:28302452-28302474 CTCTGGGCAGGGTGTGAAGGGGG + Intronic
1136247692 16:28984975-28984997 TGGCGGGTGGGGTGGGAAGGGGG + Intronic
1136336126 16:29611972-29611994 GGTTGGGTGGCGTGGGAAGGCGG - Intergenic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1136540918 16:30927340-30927362 GTGTGGGGAGGCTGGGAAGGAGG + Exonic
1136597605 16:31262310-31262332 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1137506906 16:49062010-49062032 GAGTGGGGAGGGTGGGAGGAGGG - Intergenic
1137601592 16:49760026-49760048 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601617 16:49760139-49760161 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601637 16:49760228-49760250 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137677272 16:50309873-50309895 GTGTGGGTAGGCAGGGAGTGAGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137785266 16:51133243-51133265 GTGGGGGTGGGGGGGGAGGGAGG + Intergenic
1137881187 16:52050208-52050230 ATGTGTTTAGGGTGGGTAGGGGG + Intronic
1138232478 16:55348868-55348890 GTGGGGGTAGGGTGGGGGGTGGG + Intergenic
1138605148 16:58083857-58083879 GTGTGGGTTGGGTGGGGGTGTGG - Intergenic
1138613812 16:58148454-58148476 GTGTCGGTAGGGTGTGGAGGGGG - Intergenic
1138635979 16:58338781-58338803 GTTGGGGAAGGGTGGGAAGGAGG - Intronic
1138736758 16:59259873-59259895 TTGTGGGTGGGGTGGGATGGGGG + Intergenic
1138938950 16:61766134-61766156 AAGGGGGTAGGGTGGGAGGGAGG - Intronic
1138944672 16:61834261-61834283 GTGTGTGTCTGGTGGGAGGGTGG + Intronic
1139274400 16:65714172-65714194 GGCTGGGTGGGGTGGGAAGTTGG - Intergenic
1139495839 16:67316827-67316849 GTGGGGGTTGGGTGGGCAGGTGG + Intronic
1139497146 16:67327918-67327940 GTTTTGGGAGGGTGGGGAGGAGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140012950 16:71154540-71154562 GTGGGGGTTGGGTGGGGAGTTGG - Intronic
1140615563 16:76658343-76658365 GAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1140620238 16:76720880-76720902 TTGCGGGAAGAGTGGGAAGGGGG + Intergenic
1140866597 16:79067618-79067640 GTGTGGGTGGGGTGGGGGGCGGG + Intronic
1140870527 16:79102074-79102096 GTGTGGGGAGGGTGGGGCGGGGG + Intronic
1140914621 16:79482969-79482991 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140914716 16:79483205-79483227 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140927478 16:79598631-79598653 GTGTGTGTAGGGGGCCAAGGGGG + Intronic
1140928465 16:79605310-79605332 GTGTGTGTAGGGTGGGGTAGGGG + Intergenic
1141028791 16:80570702-80570724 GAGTGGGGAGGGTGGAGAGGTGG - Intergenic
1141345012 16:83236805-83236827 GAGTGGCAGGGGTGGGAAGGAGG + Intronic
1141540168 16:84713946-84713968 CTGGGGGTTGGCTGGGAAGGTGG + Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141647737 16:85376508-85376530 GTGTGGGCAGAGTGGGCTGGGGG + Intergenic
1141693672 16:85610301-85610323 GGGAGTGGAGGGTGGGAAGGAGG + Intergenic
1141778231 16:86138680-86138702 GTGAGGACACGGTGGGAAGGTGG - Intergenic
1141881812 16:86865312-86865334 CAGGGGGTTGGGTGGGAAGGCGG - Intergenic
1142036848 16:87867748-87867770 GGTTGGGTGGCGTGGGAAGGTGG - Intronic
1142115713 16:88355076-88355098 GCCTGGGGAGGGTGGGCAGGGGG + Intergenic
1142224826 16:88872279-88872301 GAGAGGGTGGGGTGGGATGGAGG + Intergenic
1142234440 16:88915196-88915218 GTGGGTGTGGGGTGGGGAGGAGG + Intronic
1142240357 16:88941857-88941879 GTGTGGGGGGGGTGGGGAGGTGG + Intronic
1142262659 16:89050159-89050181 GAGTAGGAAGGGTGGGCAGGGGG - Intergenic
1142761557 17:2045013-2045035 GTGTGGGGAGGGGTGGGAGGTGG + Intergenic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1142895871 17:2978464-2978486 GGGTGGATAGAGTGGGATGGTGG + Intronic
1143029785 17:3961507-3961529 GAGGGAGGAGGGTGGGAAGGTGG + Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143373441 17:6454357-6454379 GTCTGGGTGGGCTGGAAAGGAGG - Exonic
1143379345 17:6486310-6486332 GTGGGGGTGGGGTGTGAAGAAGG - Intronic
1143389634 17:6552634-6552656 CTATGGGTAGGGGTGGAAGGTGG - Intronic
1143665902 17:8359928-8359950 GTGGGGGTAGAGTGGGGAGGAGG + Intergenic
1144206431 17:12982895-12982917 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
1144587545 17:16496775-16496797 GAGTGGGTAGATTGGGAGGGAGG - Intergenic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144740671 17:17580539-17580561 GTGGGGGGAGGGTGGAAAGCTGG + Intronic
1144753552 17:17666387-17666409 GAGTGTGTAGGGTGTGCAGGTGG - Intergenic
1144764759 17:17726281-17726303 GTGTGGGAAGGGTGGGGAGCAGG - Intronic
1144913395 17:18701732-18701754 GTGGGGGCAGGATGGGAATGAGG + Intronic
1145058784 17:19719546-19719568 AGGTGGAAAGGGTGGGAAGGAGG + Intergenic
1145064397 17:19752334-19752356 GGCTGGGAAGGGTGGGGAGGTGG + Intergenic
1145261874 17:21359315-21359337 GTGGGGTCAGCGTGGGAAGGGGG + Intergenic
1145318319 17:21748250-21748272 GTGTGTGTCGGGGGGGAGGGGGG - Intergenic
1145399566 17:22520277-22520299 GTGTTATTAGGGTGAGAAGGAGG - Intergenic
1145933740 17:28703301-28703323 GTGTATCTGGGGTGGGAAGGAGG - Exonic
1146086417 17:29833944-29833966 GGGAGGGTAGGAAGGGAAGGAGG - Intronic
1146262586 17:31431727-31431749 GGGTGGGGAGGCTGGGAGGGAGG - Intronic
1146273633 17:31500360-31500382 TTGTGGTCAGTGTGGGAAGGAGG - Intronic
1146619936 17:34389377-34389399 GTGTGGGCAGGATGAGAACGAGG + Intergenic
1146693523 17:34892707-34892729 GTGGGAGTGGGGTGGGGAGGTGG - Intergenic
1146741403 17:35287053-35287075 GGGAGGAAAGGGTGGGAAGGGGG - Intergenic
1146799491 17:35807249-35807271 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1146838042 17:36127869-36127891 GTATGTGCAGGGTGGGAAGATGG + Intergenic
1147153742 17:38532914-38532936 GTGAGGGGAAGGCGGGAAGGGGG + Exonic
1147182213 17:38693569-38693591 GTGGGTGTGGGGTGGGAAGGGGG + Intergenic
1147326237 17:39671077-39671099 GTGTGAATAGGGTGGGCTGGAGG - Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147424934 17:40341969-40341991 GTGGGGGCAGCCTGGGAAGGGGG - Intronic
1147772547 17:42877900-42877922 GTGGGAGTAAGGTGGGGAGGAGG + Intergenic
1147879341 17:43643873-43643895 GTGGGGGGAGGGTGGGAGGCAGG - Intronic
1147923740 17:43934149-43934171 GTATGGGGAGGGAGGAAAGGGGG - Intergenic
1148075297 17:44932209-44932231 GGGAGGGTGGGGTGGCAAGGGGG + Intronic
1148155775 17:45424662-45424684 GTGGGGGAAGGGTGGGAGGGGGG + Intronic
1148343507 17:46888234-46888256 GTGTGGGTCAGGTGGGGAGTTGG + Intergenic
1148361580 17:47016928-47016950 GGTGGGGTAGGGTGGGATGGGGG - Intronic
1148382504 17:47210062-47210084 GTGAGGGCAGGGTGGGAAGGAGG + Intronic
1148478651 17:47945801-47945823 GTGCTGGTAGGGAGGGCAGGTGG + Intronic
1148839184 17:50483820-50483842 GTGTGGGGGGGGTGGCAGGGAGG - Intronic
1148847345 17:50537135-50537157 GTGTGGCTGGGATGGGGAGGTGG + Intronic
1148897202 17:50845845-50845867 GAGAGGGCAGGGTGGGCAGGTGG + Intergenic
1149022644 17:51987370-51987392 TTGGGGAAAGGGTGGGAAGGGGG + Intronic
1149085157 17:52708039-52708061 GTGTGGGGTTGGTGGGGAGGTGG + Intergenic
1149101562 17:52912476-52912498 GAGTTGGGAGGGTGGGAAGAGGG + Intergenic
1149330412 17:55575713-55575735 GTGTGGGTAGGGAAGAAATGAGG - Intergenic
1149431959 17:56601333-56601355 GTGTGGGTTGGGGGTAAAGGAGG - Intergenic
1149658567 17:58323079-58323101 GTGTGGGGAGAGGGGGAATGTGG - Intronic
1150045538 17:61909551-61909573 ATGTTGGGAGGGTGGGAAGGGGG - Intronic
1150273704 17:63882525-63882547 GTGTGGGAGGGGTGGGGGGGGGG + Intergenic
1150387465 17:64773329-64773351 GTGGGGGAAGGGTGGGAGGGGGG + Intergenic
1150405562 17:64897500-64897522 GGTGGGGTAGGGTGGGATGGGGG + Exonic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1150623012 17:66822580-66822602 GTGAGGGGAGGTTGGGCAGGTGG - Intergenic
1151128879 17:71875235-71875257 GTGGGGGTGTGATGGGAAGGTGG + Intergenic
1151129918 17:71886104-71886126 TTGGGGGTAGAGTGGGAGGGTGG + Intergenic
1151175296 17:72283455-72283477 GGGGGGGTGGGGCGGGAAGGTGG - Intergenic
1151197914 17:72445253-72445275 GGGTGGGTGGGGCGGGGAGGAGG - Intergenic
1151229570 17:72674147-72674169 ATGTGGCAAGGGAGGGAAGGAGG - Intronic
1151274861 17:73026769-73026791 TGATGGGTAGGGTGGGGAGGAGG - Intronic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151421985 17:74004792-74004814 GTGTGAGCAGGCTGGGGAGGAGG + Intergenic
1151712073 17:75812697-75812719 GTGGGTGTAGGGTGGGATGCGGG - Intronic
1151886309 17:76925152-76925174 GTGGGGGCAGGGCGTGAAGGAGG - Intronic
1152087663 17:78230612-78230634 GTGTGTTTAGGGGGGGAACGAGG + Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152462852 17:80450379-80450401 GCGTGGGCCGGGTGGGAAGAGGG - Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152585206 17:81186220-81186242 CTGGGAGTGGGGTGGGAAGGGGG - Intergenic
1152611658 17:81317799-81317821 GTGCGGGTGGGGTGGGGTGGGGG + Intronic
1152703687 17:81832460-81832482 GTGTAGAGAGGGTGGGAAGTGGG - Intronic
1152783146 17:82235319-82235341 GAGTGGGTGGGGTGGGGAAGTGG - Exonic
1153434955 18:5059184-5059206 GTGTGGTGAGGCAGGGAAGGAGG - Intergenic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154219700 18:12441178-12441200 GGGTGGGGAGCGTGGGGAGGCGG + Intergenic
1154223465 18:12478277-12478299 GTGTAGCTAGGGTGTGAAGCTGG + Intronic
1154316090 18:13304292-13304314 GTGTGGGCAGCGTGGGGAAGGGG + Intronic
1154338187 18:13482384-13482406 CTGTGGGGAAGGTGGGACGGTGG - Intronic
1154377746 18:13823373-13823395 GTGGGGGTTGGTTGGGTAGGTGG - Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1154429127 18:14294903-14294925 AGGTGGGTAGGGTGAGAAGTAGG + Intergenic
1155032650 18:21997612-21997634 ATGTGTGTAGGGTCGGAAGGAGG - Intergenic
1155294199 18:24370600-24370622 GTGTGGACAGGCTGGGAAGTTGG - Intronic
1155336504 18:24770433-24770455 ATGTGGGTAGGGTAGGAGGCAGG - Intergenic
1155518088 18:26642873-26642895 CTGCGGGGAGGGTGGGAGGGCGG + Intronic
1156009825 18:32483789-32483811 GTGAGAGGAGGGAGGGAAGGGGG + Intergenic
1156130011 18:33961308-33961330 GTGTGTGTAGGGTGGGTGAGGGG + Intronic
1156144229 18:34156904-34156926 GTGTAGTGAGTGTGGGAAGGAGG - Intronic
1156281001 18:35638453-35638475 GTGTGTGTGGGGTGGGGAAGGGG - Intronic
1156310018 18:35913231-35913253 GTGTGTGTGTGGTGGGATGGGGG - Intergenic
1156637481 18:39048911-39048933 GTGGGGGTTGGGGGAGAAGGAGG + Intergenic
1156798579 18:41079675-41079697 GAGGAGGAAGGGTGGGAAGGAGG - Intergenic
1157091322 18:44640492-44640514 TTGAGAGTAGGGTGGGAGGGAGG - Intergenic
1157239674 18:45997632-45997654 GGGAGGGGAGGGAGGGAAGGGGG - Intronic
1157300730 18:46477314-46477336 CTGGGGGTAGGGTGGGGAGCAGG + Intronic
1157349239 18:46870100-46870122 GTGTGGTTAGGGAGGGCACGGGG - Intronic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157778809 18:50419570-50419592 GAGTAGGGAGGGTGGGAAGAGGG - Intergenic
1157792704 18:50546692-50546714 GTGAGGGGAGGGTTGGAAGGTGG + Intergenic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1158490717 18:57907265-57907287 GTGTGGGGAGAGGGAGAAGGAGG - Intergenic
1158573307 18:58614904-58614926 GTGTGTGTTGGGGGGGAGGGTGG - Intronic
1158832086 18:61290710-61290732 GTGTGGCCTGTGTGGGAAGGAGG + Intergenic
1159073063 18:63647693-63647715 GTGTTGGCAGAGTAGGAAGGAGG - Intronic
1159074632 18:63666444-63666466 GTGTTGGTTGAGTAGGAAGGAGG - Intronic
1159186153 18:64977105-64977127 GATTGGGTAGGTTGGGCAGGGGG + Intergenic
1159781966 18:72670139-72670161 GGGTGGGAAGGGTAGGAATGAGG + Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1159970600 18:74647751-74647773 GTGTGGGCATGGTGACAAGGTGG + Intronic
1160051841 18:75440966-75440988 GTGTGGTGAGGGAGGGATGGAGG + Intergenic
1160117118 18:76089849-76089871 GTGGGTGTTGTGTGGGAAGGAGG + Intergenic
1160238174 18:77102145-77102167 GTGGCAGCAGGGTGGGAAGGAGG + Intronic
1160363122 18:78301124-78301146 AGGTGGGGAGGGCGGGAAGGAGG - Intergenic
1160632873 18:80258670-80258692 GTGTGGGGTGGGTGGGTGGGGGG + Intergenic
1160749234 19:726215-726237 GTGTGGTCAGGGTGGGGAAGTGG + Intronic
1160828104 19:1090014-1090036 GTGTGTGTGGGGGGGGAACGCGG + Intronic
1160893730 19:1393181-1393203 GTGGAGGGAGGGTGGGCAGGCGG + Intronic
1160978556 19:1806203-1806225 GTGTGGGGAGGGTTGGCAGAGGG - Intronic
1161127497 19:2566586-2566608 GTGGGGGTGGGAGGGGAAGGAGG - Intronic
1161253512 19:3293810-3293832 GTGGGGGTGCGGTGGGGAGGGGG + Intronic
1161290355 19:3490776-3490798 GTGAGGGGAGCGTGGGAGGGAGG - Intergenic
1161445018 19:4313404-4313426 GTGGAGGTAGGGTCTGAAGGGGG + Intronic
1161447973 19:4328624-4328646 GTGGGAGGAGGGTGGGAAGAGGG - Intronic
1161605359 19:5211921-5211943 CTGTGGGCGGGGTGGGGAGGAGG - Intronic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1161842393 19:6690595-6690617 GGTAGGGTAGGGTGGGAAGATGG + Intronic
1161852561 19:6745180-6745202 GCGGGGGCAGGGTGGGGAGGTGG + Intronic
1162307242 19:9882602-9882624 GTGTGAGTGGGGTAGGAATGTGG + Intronic
1162310075 19:9900996-9901018 GAGGGGGGAGGGAGGGAAGGAGG + Intronic
1162412632 19:10515621-10515643 GTGTGTGTTTGGTGGGGAGGGGG - Intronic
1162861545 19:13509209-13509231 GTGTGTGTGGGGTGGCGAGGGGG - Intronic
1162870216 19:13580858-13580880 GGGAGGCTAAGGTGGGAAGGTGG - Intronic
1163156830 19:15444245-15444267 GTGGAGGTAGGGTGGGGAGAGGG + Intronic
1163587760 19:18173280-18173302 GTGGGGGTTGGGTGTGAGGGAGG + Intronic
1163672189 19:18636098-18636120 TTATAGGTAGGGTGGGAGGGAGG - Intergenic
1164298712 19:23939115-23939137 GGGGGGGAAGAGTGGGAAGGGGG - Intronic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164644207 19:29845855-29845877 TTGTGGGTCGGGTGGGGTGGAGG - Intergenic
1164685657 19:30164951-30164973 GTGGGGGTGGGGGGTGAAGGGGG + Intergenic
1164723986 19:30452976-30452998 GTGTCGGGGGGGTGGGCAGGTGG + Intronic
1164785122 19:30924381-30924403 GTGTGTTTGGGGTGGGGAGGAGG + Intergenic
1165008441 19:32824997-32825019 GTGAAGCTAGGGTGCGAAGGAGG - Intronic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165408028 19:35642557-35642579 GTGTGGGGAGGGTGTCCAGGTGG + Intronic
1165445638 19:35855620-35855642 GGGTGGGTAGTGTGGCCAGGAGG - Intronic
1165460259 19:35940075-35940097 GAGTGGGTCGGGTGGGATTGTGG - Exonic
1165602133 19:37063545-37063567 GTGGGGGTAGGCGGGGGAGGGGG - Intronic
1165701586 19:37942514-37942536 GTGGGGTGGGGGTGGGAAGGAGG + Intronic
1165767742 19:38361558-38361580 AAGTGGGTGGGGTGGGAAAGAGG + Intronic
1165797134 19:38525930-38525952 GTCTTGGCAGGGAGGGAAGGAGG - Intronic
1165931336 19:39361241-39361263 TTTTGGGGAGGGTGGGGAGGAGG - Intronic
1166034009 19:40154194-40154216 GGGTGGGTGAGGTGGGAATGGGG + Intergenic
1166040369 19:40198610-40198632 GTGAGGGCAGAGTGGGAGGGAGG + Intronic
1166053228 19:40273678-40273700 GTGTGTGTGGGGTGGCAGGGAGG - Intronic
1166104166 19:40589440-40589462 GTGGGGTCAGGGTGGGATGGGGG + Intronic
1166302293 19:41918110-41918132 ATGTGGGCAGTGTGGGAATGGGG - Intronic
1166706403 19:44910379-44910401 GTGCAGGGTGGGTGGGAAGGAGG - Intergenic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1166794238 19:45416743-45416765 GGCTGGGCAGGGTGGGATGGGGG + Intronic
1166948082 19:46409243-46409265 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1166970573 19:46564502-46564524 GTGAGGGTAGGGGGAGAGGGAGG + Intronic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167706937 19:51086678-51086700 GTGTGGAGAGGGTAGGAGGGAGG + Intergenic
1168075477 19:53978865-53978887 GGGTAGGGAGGGAGGGAAGGAGG + Intronic
1168108504 19:54179108-54179130 GTGCCTGTAGGGTAGGAAGGTGG + Intronic
1168146053 19:54420610-54420632 GTGTCGGTAGGGTGGGGGCGGGG + Intronic
1168184752 19:54692570-54692592 GGCTGGGAAGGGTGGGAAGAGGG + Intronic
1168713443 19:58514363-58514385 GTGGGGGTGGGGTGGGGTGGGGG - Intronic
1202697524 1_KI270712v1_random:135824-135846 GGAAGGGGAGGGTGGGAAGGGGG - Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925347795 2:3183011-3183033 GTGAGGGGTGGGTGGGTAGGTGG - Intergenic
925693156 2:6546443-6546465 GTGTAGGTAGATTGGAAAGGTGG - Intergenic
926016939 2:9461718-9461740 AGGTGTGCAGGGTGGGAAGGAGG + Intronic
926079502 2:9972947-9972969 ATGTGGGCGGTGTGGGAAGGTGG + Intronic
926151342 2:10427195-10427217 CTGTGGGAAGGGTGGGGACGAGG + Exonic
926212315 2:10880275-10880297 GGGTGGGGCGGGTGGGGAGGGGG - Intergenic
926566076 2:14475619-14475641 GAGGGGGTAGAGTGGGATGGGGG + Intergenic
926737052 2:16081846-16081868 GGGTGGGTGGGGTGGGTGGGTGG - Intergenic
927125356 2:20008286-20008308 GCGTGTGTTGGGTGAGAAGGGGG - Intronic
927144314 2:20151645-20151667 GTGTGTGTTGGGTGGGGAGTTGG + Intergenic
927200842 2:20577253-20577275 GTGGGGAGAGGGTGGGAAAGGGG + Intronic
927784549 2:25964703-25964725 GTGTGGATAGCTGGGGAAGGTGG - Intronic
927868470 2:26608261-26608283 GAGTGGGTCTGGTGAGAAGGGGG + Intronic
927940956 2:27102505-27102527 GGGTGAGTAGGGTGGGCCGGGGG - Exonic
928359880 2:30654614-30654636 GGGTGGGTGGGCTGGGAAAGGGG - Intergenic
928372429 2:30750305-30750327 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
928432920 2:31235022-31235044 TATTGGGTAGGATGGGAAGGGGG - Intronic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928593695 2:32841167-32841189 GTGTGGGTTAGGTGGAATGGTGG + Intergenic
928602451 2:32916221-32916243 GCGTGGGTAGGGGGGGGGGGTGG + Intergenic
928787351 2:34904878-34904900 GTGTGTGTTGGGCGGGAGGGTGG + Intergenic
928923676 2:36553958-36553980 GTGTGGGAAGGTGGGGAAGTCGG - Intronic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
929545963 2:42855404-42855426 CTCTGGGTAGGGTGTGAATGGGG - Intergenic
929713858 2:44291636-44291658 CTGGGGGTAAGGTGGGGAGGAGG - Intronic
929853445 2:45614058-45614080 GTGTGGGTGGCGGGAGAAGGTGG - Intergenic
930130963 2:47850148-47850170 GAGTGGGTATGGTGGGCTGGGGG + Intronic
930221403 2:48750085-48750107 GTGAGGGTAGGCTAGGGAGGTGG + Intronic
930399763 2:50868386-50868408 GACTGGGAAGGGTGGGATGGAGG + Intronic
930576086 2:53150517-53150539 GTGTGGGTGGGGAGAGAGGGAGG + Intergenic
930730777 2:54725293-54725315 GCGTGTGGAGGCTGGGAAGGTGG + Intronic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
930814815 2:55584493-55584515 TTGGGGAAAGGGTGGGAAGGGGG - Intronic
931217692 2:60261881-60261903 GGGTTGGAAGGGTGGGAAAGGGG - Intergenic
931277612 2:60756998-60757020 TTGTGGGTAGGTGGGGAAGCAGG - Intronic
931583407 2:63801763-63801785 TTCTGGGTAGGGTGGGAACTTGG - Intronic
931683079 2:64768734-64768756 GTGTAGGGAGAGAGGGAAGGAGG - Intergenic
931881363 2:66574428-66574450 GTGGGGGGGGGGTGGAAAGGGGG + Intergenic
932110381 2:68993988-68994010 GGGTGTGTGGGTTGGGAAGGAGG - Intergenic
932120115 2:69090994-69091016 TTGTTGGTGGGGTGGGAAAGAGG + Intronic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932336156 2:70932627-70932649 GTGGGGGTGGGGTGTGAGGGTGG - Intronic
932488813 2:72105305-72105327 CTGTGGGGAGGCTGGGAAGCAGG - Intergenic
932493616 2:72136080-72136102 GGGTGAGGAGGGTGGCAAGGGGG - Intronic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
932688595 2:73893797-73893819 GTGTGTGTTGGGTGGGTTGGGGG - Intronic
932691985 2:73921158-73921180 CTGTGGGTGGGGTGGGATGGAGG + Intergenic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
932890581 2:75593045-75593067 GAGAAGGAAGGGTGGGAAGGTGG - Intergenic
932948837 2:76269475-76269497 GAGGGGGTGGGGTGAGAAGGGGG - Intergenic
933132665 2:78691875-78691897 GTGTGTGTGGGGTGGGGGGGAGG - Intergenic
933229854 2:79793978-79794000 GGGAGGAAAGGGTGGGAAGGGGG + Intronic
933708473 2:85308478-85308500 GGGGGGGAAGGGAGGGAAGGAGG - Intronic
933730934 2:85455851-85455873 GTGGAGGCAGGGTGGGGAGGAGG + Intergenic
934662496 2:96150533-96150555 GTGCTGGTGAGGTGGGAAGGAGG - Intergenic
934880447 2:97972449-97972471 GGGAGGGGAGGGAGGGAAGGCGG + Intronic
934893365 2:98089509-98089531 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
935112149 2:100104274-100104296 GTGGGGGTGGGGTGGGTCGGGGG - Intronic
935196590 2:100820046-100820068 GTGGGGGTAGGAGGGGGAGGTGG + Intergenic
935326914 2:101945920-101945942 ATGGGGGTAGGGTGGGGAGCTGG - Intergenic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
935602840 2:104940185-104940207 GTGCGGGTGGGGTGGGGTGGAGG - Intergenic
935640688 2:105287193-105287215 GGGGGTGTAGGGTGGGGAGGTGG + Intronic
936086591 2:109473715-109473737 GAGTGGGTGGGGTGGGTGGGTGG - Intronic
936122826 2:109760877-109760899 GTGGGGGTGGGGTGGGTCGGGGG + Intergenic
936160338 2:110079956-110079978 GTGTGGGCAGGCTGGGAGGTAGG + Intergenic
936184326 2:110291398-110291420 GTGTGGGCAGGCTGGGAGGTAGG - Intergenic
936221863 2:110610587-110610609 GTGGGGGTGGGGTGGGTCGGGGG - Intergenic
936333931 2:111572928-111572950 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936333943 2:111572961-111572983 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936674856 2:114702992-114703014 GGGTGAGCAGGGTGGGAAGAAGG + Intronic
936728574 2:115354321-115354343 GAGGGGGTAGGGAGGGAATGTGG - Intronic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937387973 2:121454318-121454340 GGGAGAGCAGGGTGGGAAGGAGG - Intronic
937815950 2:126251132-126251154 CTGTAGGGAGGATGGGAAGGTGG + Intergenic
937855125 2:126666690-126666712 GTGTAGGGAGGGAGGGGAGGGGG - Intronic
937907700 2:127060434-127060456 GTGCGTGTTGGGTGGGAAGGCGG - Intronic
937949891 2:127376307-127376329 GGGGTGGGAGGGTGGGAAGGGGG + Intronic
938081642 2:128373437-128373459 GTGGGGGTGGGGTGGGGTGGGGG - Intergenic
938090242 2:128426505-128426527 GTGTGGGGAGGATGGGAGGAGGG - Intergenic
938170529 2:129071606-129071628 GTGAGGGTGGGGTGGAAAAGAGG - Intergenic
938422030 2:131153782-131153804 ATGTGGATAGCGTGGGAACGTGG + Intronic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
939586775 2:144015440-144015462 GTGAGGGGAGGGTGGGTATGGGG - Intronic
939660424 2:144882156-144882178 AAGTGTGGAGGGTGGGAAGGTGG - Intergenic
939992357 2:148887805-148887827 GCGTGGGGAGGGCGGGAAGGGGG - Intronic
940670604 2:156662484-156662506 GTTGTGCTAGGGTGGGAAGGTGG - Intergenic
941225146 2:162838829-162838851 GTGGGGGTGGGGTGGGAAGGGGG + Intergenic
941758329 2:169212764-169212786 TTGGGGGAAGGGTGGGAGGGGGG + Intronic
941781662 2:169452324-169452346 GTGGGGGTAGGGGTGGGAGGTGG - Intergenic
941859781 2:170267143-170267165 CTGGGGGTAGGGTGGGAATTGGG + Intronic
942192405 2:173483183-173483205 GTGTTGGGAGGGTGGGTAGCGGG + Intergenic
943255040 2:185583782-185583804 GTGGGGGAAGAGTGGGAAGAGGG + Intergenic
943662531 2:190574776-190574798 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
944053304 2:195496000-195496022 GAGTGAGTGGGGTGGGGAGGTGG - Intergenic
944283870 2:197925777-197925799 GTGTGGGAAGGTTTGGCAGGAGG - Intronic
944777918 2:202987981-202988003 GTGATGGTGGGGTGGCAAGGAGG - Intronic
944778981 2:202998224-202998246 GAGTGGGGAGGGTGGGATAGGGG - Intronic
944822444 2:203444080-203444102 GTGAGGGGAGGGAGGAAAGGAGG + Exonic
944845098 2:203660126-203660148 GTGGGGGTGGGGTGGGAATGGGG + Intergenic
945254491 2:207792274-207792296 GTGGGGGGAGGGGGGGAAGGGGG - Intergenic
945257268 2:207813180-207813202 GTGGGGGTGGGGGGAGAAGGGGG - Intergenic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
946042543 2:216794972-216794994 GTTTGGGAAGGGTGGGGAGTTGG + Intergenic
946063634 2:216967769-216967791 GATTGGGGAGGATGGGAAGGAGG + Intergenic
946224908 2:218259300-218259322 GTGTGGGATGTGTGTGAAGGGGG - Intergenic
946299655 2:218814783-218814805 GTGTGGGCAGGGAGGGGTGGAGG + Intronic
946325035 2:218980750-218980772 GTGAGGGTTGGGTGGAAGGGTGG + Intergenic
946431961 2:219630919-219630941 GTGTGGGTGGGGTGGGGGGAAGG + Intronic
946487120 2:220111479-220111501 GTATGGGTGGGGTGGGGTGGAGG + Intergenic
946786112 2:223246197-223246219 GTGTGGGTAGGTGGGGCTGGAGG + Intergenic
946832537 2:223741080-223741102 GTGGGGATGGAGTGGGAAGGTGG + Intergenic
947017541 2:225638184-225638206 GTGTGTGTGGTGTGGGAGGGGGG + Intronic
947101706 2:226628286-226628308 GAGTGGGTGGGATGGGATGGTGG - Intergenic
947189505 2:227487731-227487753 GGGTGGGTAGGGTGGGGTGTGGG + Intronic
947505596 2:230706127-230706149 GTGTGGGTAGGGTGGAAGGATGG + Intergenic
947749651 2:232525612-232525634 GTGTGGGTGGGATGGGGTGGGGG + Exonic
948100299 2:235367598-235367620 GTGAGGGGAGGGTGAGGAGGTGG - Intergenic
948204965 2:236158884-236158906 GTGGGGGAAGGGTGGGACAGTGG - Intergenic
948306310 2:236949604-236949626 GTGGGGGTGGGGCGGGGAGGCGG - Intergenic
948313419 2:237007791-237007813 GTGTGGCTGGGGTGGAGAGGGGG + Intergenic
948416954 2:237814891-237814913 GTGTGTGTAGGGGGGGGTGGGGG - Intronic
948765512 2:240216944-240216966 GGGTGGGTGGGGTGGGGTGGAGG + Intergenic
948765559 2:240217047-240217069 GGGTGGGTGGGGTGGGGTGGAGG + Intergenic
948786703 2:240356387-240356409 GTGTGGGAAGGGTGTGAAGAGGG + Intergenic
948940058 2:241191022-241191044 GGGTGGGTAGGGGGTGGAGGGGG - Intronic
949033825 2:241807601-241807623 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
949033941 2:241807882-241807904 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
1168779926 20:480272-480294 GTGTGTGTAGGGAGAGAAAGGGG + Intronic
1168958332 20:1850067-1850089 GGGTGGGGAGGTGGGGAAGGAGG + Intergenic
1169087958 20:2839079-2839101 GGGTGGGGGGGGTGGGTAGGGGG - Exonic
1169157019 20:3340434-3340456 GTGGGGGTGGGGTGGGTGGGGGG - Intronic
1169216258 20:3796412-3796434 GGGTGGGGGGGGGGGGAAGGAGG - Exonic
1169331187 20:4717636-4717658 GTATGGGGAGGATGGGAGGGAGG - Intergenic
1169391172 20:5192342-5192364 GTGGGGGTGGGGTGGGGAAGGGG + Exonic
1169492589 20:6083661-6083683 GTGTGGGGAGGGTGGCCGGGGGG - Intronic
1169516861 20:6326219-6326241 GGGTGTGGAGGGAGGGAAGGTGG + Intergenic
1169781188 20:9312339-9312361 GTGTGTGTAGGGTGGAAGGTGGG - Intronic
1170182079 20:13543228-13543250 GTGTGGGTGGGGTGGGGATGAGG - Intronic
1170255201 20:14334657-14334679 GTGGGGGGTGGGAGGGAAGGGGG + Intronic
1170848664 20:19983819-19983841 ATGAGGTTAGGGTGGGAGGGAGG - Intronic
1170848944 20:19986320-19986342 ATTTGGGGAGGGTGGGGAGGAGG + Intronic
1170888987 20:20363789-20363811 GTGTGAGTGGGGTGGGAGGAAGG + Intergenic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1171151924 20:22834951-22834973 GTGTAGGGAGGGAGAGAAGGAGG - Intergenic
1171250153 20:23640393-23640415 GAGTGGCGAGGGTGGAAAGGAGG + Intergenic
1171396339 20:24836227-24836249 GTGTGTGGAGGGTGGGCAGGTGG - Intergenic
1171958730 20:31478180-31478202 GGGTGGGAGGGGTGGGAAGAGGG - Intronic
1172110013 20:32539021-32539043 GTGGGGGTGGGGTGGGGTGGGGG + Intronic
1172122003 20:32604016-32604038 GAGGGGGCAGGATGGGAAGGTGG - Intronic
1172125073 20:32621001-32621023 GGGTGGCTGGGGTGGGAAGGAGG + Intergenic
1172448605 20:35006210-35006232 TTGTGGGTAGGGAGTGAGGGTGG - Intronic
1172646711 20:36474778-36474800 GTGGAGGTGGGGTAGGAAGGAGG - Intronic
1172649528 20:36493035-36493057 CTGTGGGTAGGGTGGGGATGGGG - Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1172775027 20:37402325-37402347 GTGTGGGGAGGGTGGGGAAGGGG + Intronic
1172798156 20:37557625-37557647 GTGTGTGTAGGGTGGTAGGGTGG + Intergenic
1173160075 20:40645969-40645991 GTGTGGGTGGGGTGGATAGGAGG + Intergenic
1173177767 20:40777448-40777470 GTGGGGGTGGGGTGGGAGGGTGG - Intergenic
1173737586 20:45372919-45372941 GAGTGGGCGGGGTGGGAGGGGGG + Exonic
1173756546 20:45521729-45521751 GGGTGGGGAGGGAGGGAAAGAGG - Intergenic
1173825224 20:46043812-46043834 GTGCAGGAAGGGTGGGGAGGGGG + Intronic
1173870877 20:46341473-46341495 GAGTGGGCAGGGAGGGACGGGGG - Intergenic
1173974323 20:47175623-47175645 ATCTGGGGAAGGTGGGAAGGAGG + Intronic
1173985061 20:47254721-47254743 GTGGGGGTGGGGTGGGGTGGAGG + Intronic
1174135685 20:48377415-48377437 GTGGGGGTCTTGTGGGAAGGTGG - Intergenic
1174175367 20:48641094-48641116 GGATGAGTAGGGTGGGTAGGTGG + Intronic
1174267307 20:49341130-49341152 GAGAGGGAAGGGGGGGAAGGGGG - Intergenic
1174300770 20:49580467-49580489 GTAGGGGGAGGGTGGGGAGGAGG - Intergenic
1174468970 20:50741406-50741428 ATGTGGTAAAGGTGGGAAGGTGG - Intronic
1174575947 20:51537247-51537269 GTGTGGGTGGGGGGTGCAGGGGG + Intronic
1174656590 20:52177028-52177050 GGGAGGGTAGGGTGGGATGTGGG - Intronic
1174691514 20:52511067-52511089 AGGTGGAAAGGGTGGGAAGGGGG + Intergenic
1174932650 20:54832600-54832622 GGGTGGGTAGTCTGGGAGGGGGG + Intergenic
1175050030 20:56146689-56146711 GTGTGTGTGGGGGGGGATGGGGG - Intergenic
1175522387 20:59610281-59610303 GTGGTGTTAGGGTGAGAAGGGGG - Intronic
1175619773 20:60433551-60433573 GTGTGGTAAGTGTGGGATGGCGG + Intergenic
1175782795 20:61694234-61694256 GCGCAGGTAGAGTGGGAAGGAGG + Intronic
1175834194 20:61982885-61982907 GTGGGGGACGGGTGGGGAGGGGG - Intronic
1175899464 20:62354342-62354364 GGATGGGTAGGGAGGGAGGGAGG - Intronic
1175961032 20:62636438-62636460 GTGCGGGTAGGGAGGGGAGGTGG + Intergenic
1175998801 20:62822819-62822841 TGGTGAGGAGGGTGGGAAGGGGG - Intronic
1176041926 20:63070251-63070273 GGGAGGGTGGGGTGGGGAGGAGG - Intergenic
1176212918 20:63933947-63933969 GGTGGGGTAGGGTGGGAAAGAGG + Exonic
1176220876 20:63968945-63968967 GTGAGGGTTGAGTGGGCAGGTGG + Intronic
1176304235 21:5114953-5114975 GTGTGGACATGCTGGGAAGGAGG - Intergenic
1176553166 21:8238830-8238852 GTGGGGGTGGGGTGGGTTGGGGG + Intergenic
1176572088 21:8421854-8421876 GTGGGGGTGGGGTGGGTTGGGGG + Intergenic
1176579997 21:8466437-8466459 GTGGGGGTGGGGTGGGTTGGGGG + Intergenic
1176845646 21:13874517-13874539 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1176848378 21:13894071-13894093 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1177272192 21:18864105-18864127 GAGGGTGTAGGGTGGGAAGAGGG - Intergenic
1177774085 21:25549092-25549114 GTCTGGGGAGAGTGGGAAGCAGG - Intergenic
1177948266 21:27500569-27500591 GTGGTGGCAGGGTGGGGAGGGGG + Intergenic
1178032043 21:28539029-28539051 AAGTGGGGAGGGTGGAAAGGGGG - Intergenic
1178097796 21:29234499-29234521 GTGGGGATGGAGTGGGAAGGTGG + Intronic
1178408400 21:32344860-32344882 GAGTGGGTAGTGTGGGGAGCAGG - Intronic
1178666862 21:34555625-34555647 TGGTGGGAAGTGTGGGAAGGAGG + Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178822086 21:35984466-35984488 GTGGGGGTGGGGTGGGGAGGAGG + Intronic
1179217631 21:39380920-39380942 GGGTGGGTAGGGTGGGAGACAGG + Intronic
1179232297 21:39515768-39515790 GTGTGGGGATGATGGTAAGGAGG + Intergenic
1179315647 21:40241996-40242018 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1179318356 21:40267024-40267046 AAGTGGGGAGGGTGGGAGGGAGG + Intronic
1179354116 21:40642685-40642707 GGGTGGCTAGGGTGGGAGGATGG - Intronic
1179726508 21:43344140-43344162 GTGTGGGCAGGGCTGGAGGGGGG + Intergenic
1179852821 21:44147077-44147099 GTGTGGACATGCTGGGAAGGAGG + Intergenic
1180043097 21:45290346-45290368 ATGTGGTTAGAGTGGGAGGGGGG + Intergenic
1180188016 21:46150060-46150082 GTGCAGGGAGGGTGGGGAGGCGG - Intronic
1180569792 22:16704184-16704206 GTGGCTGCAGGGTGGGAAGGAGG - Intergenic
1180794231 22:18594111-18594133 GTAGGGGTGGGCTGGGAAGGAGG - Intergenic
1181038081 22:20179414-20179436 ATGTGGGTAGGGTGGGGCAGGGG + Intergenic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181106122 22:20576711-20576733 GTGTGGCTGTGGTGGAAAGGAGG + Intronic
1181227509 22:21401209-21401231 GTAGGGGTGGGCTGGGAAGGAGG + Intergenic
1181251141 22:21533630-21533652 GTAGGGGTGGGCTGGGAAGGAGG - Intergenic
1181359424 22:22323288-22323310 GTGTGGGGAGGGAGGGAGTGGGG + Intergenic
1181371816 22:22424933-22424955 GGGGGGGTAGGGTGGGGTGGGGG + Intergenic
1181494408 22:23279945-23279967 GTGAGGGTACAGTGGGAGGGTGG - Intronic
1181577166 22:23802417-23802439 GAGGGGGTAGGATGGGAGGGAGG - Intronic
1181674979 22:24445497-24445519 GTGTGGGGAGGAGGAGAAGGTGG - Intergenic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182050698 22:27310593-27310615 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182050708 22:27310612-27310634 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182123934 22:27802918-27802940 GTGTGTGTAGGGAAGGAGGGGGG + Intergenic
1182243161 22:28933713-28933735 GTGTGGGGGGGGTGGGGTGGGGG - Intronic
1182276726 22:29194405-29194427 GTGTGTGTTGGGTGGGGCGGGGG + Intergenic
1182282748 22:29226609-29226631 AGGTGGGGAGGGTGGGATGGTGG - Intronic
1182344439 22:29651122-29651144 GTGTGGGTATAGTAGGGAGGGGG + Intronic
1182692867 22:32176017-32176039 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1182719853 22:32388658-32388680 GTGTGGGTAGGATGGAATGGTGG - Intronic
1182808216 22:33093749-33093771 GTGTGGGGGCGGTGGGATGGAGG + Intergenic
1183038934 22:35161697-35161719 GGGTGGGCTGGGTGGAAAGGTGG + Intergenic
1183055535 22:35303117-35303139 GTGTGTGTTGGGAGGGGAGGTGG - Intronic
1183305956 22:37083354-37083376 GAGTGGGGAGGGTGGGCAAGGGG - Intronic
1183353517 22:37346393-37346415 GCCTGGGTTGGGAGGGAAGGAGG - Intergenic
1183432562 22:37774570-37774592 GTGTGGGTAGGGTGTGAGTGGGG - Exonic
1183504961 22:38203624-38203646 GGGTGGGTGGAGGGGGAAGGTGG - Intronic
1183698772 22:39438103-39438125 GAGTGAGGAGGGAGGGAAGGGGG - Intergenic
1184852692 22:47129798-47129820 GTGTGAGGAGGCTGGGATGGAGG - Intronic
1185063721 22:48620595-48620617 GGGTGGATAGGATGGGTAGGGGG - Intronic
1185119345 22:48956643-48956665 GTGTGGGTGTGGTGTGAATGTGG - Intergenic
1185119353 22:48956743-48956765 GTGTGGGTGTGGTGTGAATGTGG - Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185311802 22:50160209-50160231 GTGGGGGGAGGGGGAGAAGGGGG - Intronic
1185351184 22:50340166-50340188 GTGTGTGTAGGGTGTGTATGTGG + Intergenic
1185351205 22:50340323-50340345 GTGTGTGTAGGGTGTGTATGTGG + Intergenic
1203258164 22_KI270733v1_random:155872-155894 GTGGGGGTGGGGTGGGTTGGGGG + Intergenic
949174561 3:1044206-1044228 GTGTGGGTGGAGGTGGAAGGTGG - Intergenic
949597341 3:5561966-5561988 GAGTGAGTAGGGTGGGAGAGTGG + Intergenic
949607349 3:5668289-5668311 GAGAGGGGAGGGTGGGAAGAGGG + Intergenic
949851554 3:8425764-8425786 GTGTTGCTAGACTGGGAAGGGGG - Intergenic
950056924 3:10032451-10032473 GTGTGTGGAGGGGGGGAATGGGG + Intronic
950081181 3:10223329-10223351 GTGGTGGTAGGGTGGGATGCTGG - Intronic
950195369 3:11005708-11005730 GAGAGAGGAGGGTGGGAAGGAGG - Intronic
950541632 3:13616643-13616665 GCCTGGGTGGGGTGGGAAGGAGG + Intronic
950758583 3:15199758-15199780 AAGTGGGTAGCGTGGGAAAGAGG + Intergenic
950762415 3:15243789-15243811 GTGGGGGGAGGGTGGGAGGAGGG + Intronic
950989344 3:17415841-17415863 GTGAGGTGAGGGTGGGAAGAAGG - Intronic
951508277 3:23473578-23473600 GTGGGGAAAGGGTGGGAAGGGGG - Intronic
951534676 3:23729862-23729884 GAGTGGGCAGGGTGAGAAGTAGG - Intergenic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951694634 3:25433507-25433529 GCGTGGACAGGGTGGGGAGGAGG + Intronic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
951745253 3:25971044-25971066 GTGAGGACAGGGTGAGAAGGTGG + Intergenic
951896986 3:27618906-27618928 AGGTTGGTAGGGAGGGAAGGTGG - Intergenic
952324433 3:32308150-32308172 GAGTCGGTAGAGTGCGAAGGAGG - Intronic
952619816 3:35324215-35324237 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
953056577 3:39392255-39392277 GTGAGGATAGGGTGGGTGGGAGG + Intronic
953184440 3:40625147-40625169 GTGTGGGGAAGGTGGGAGGCAGG + Intergenic
953390326 3:42530143-42530165 GAGTGGGTGGGGTGGGAGTGTGG + Intronic
953391662 3:42537370-42537392 GGGAGGGTGGGGTGGCAAGGGGG - Exonic
953557508 3:43958459-43958481 ACGTGGGAAGGGTGGGAAGACGG - Intergenic
953582668 3:44171580-44171602 GAGTGGGGTGGGTGGGAGGGTGG - Intergenic
953726021 3:45399785-45399807 TTGGGGGAAGGGTGGAAAGGGGG - Intronic
953929092 3:46997059-46997081 GTGTGGGTGGTGTGTGCAGGAGG + Intronic
954418997 3:50408708-50408730 GTGAGAGGAGGGTGGGCAGGCGG + Intronic
954456072 3:50600516-50600538 GTGGGGGTAGTGGGGGAAGGGGG + Intergenic
954460826 3:50625921-50625943 GTGGGGGTGGGGAAGGAAGGAGG + Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
954796161 3:53162137-53162159 GGAGGGGTGGGGTGGGAAGGGGG - Intronic
955156431 3:56421327-56421349 GTGTGGGTAAGGTGGTGAGGAGG - Intronic
955219436 3:57011560-57011582 CTGTGGGTGGCGGGGGAAGGTGG - Intronic
955425373 3:58783995-58784017 GTGGTGGAAGGGAGGGAAGGAGG - Intronic
955446890 3:59021482-59021504 GTGTAGGCAGGGTGGGCAGATGG - Intronic
955517242 3:59738441-59738463 GAGTGAGTGGGGTGGGAAAGTGG - Intergenic
955665794 3:61348034-61348056 GTGTAGCAAGGGTGGGGAGGTGG + Intergenic
956084496 3:65595818-65595840 GGGTGGGTAGGGTGGGGGTGGGG + Intronic
956159669 3:66335891-66335913 GTGGTGGTGGGGAGGGAAGGAGG + Intronic
956305420 3:67819125-67819147 GTGTGGGGTGGGCGGGAAGCAGG + Intergenic
956473037 3:69588867-69588889 GTGTGGGGAGAGTGGGAAAGTGG - Intergenic
956638443 3:71390565-71390587 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
956681845 3:71788340-71788362 GTGTGGGGGGGGTGGGGTGGGGG - Intergenic
956754056 3:72368136-72368158 GTTTGGGGAGGGTCGGAATGAGG - Intergenic
957315445 3:78570240-78570262 GTGAGGGTGGGGTGGGTGGGGGG + Intergenic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957556748 3:81771895-81771917 GTGTGTGTTGGGTGGGGGGGGGG + Intergenic
957590029 3:82184859-82184881 GTGTGTGTATGTTGGGATGGGGG + Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
957989882 3:87614441-87614463 GTGTGGTTAGGGAAGGCAGGGGG + Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
958688859 3:97434884-97434906 GGGTAGGGAGGGTGGGAAGAAGG - Intronic
958723089 3:97870285-97870307 GAGTGGGGAGGATGGGAAGAGGG - Intronic
959006836 3:101029135-101029157 GAGTGTGGAGGGTGGGAAGAGGG - Intergenic
959110058 3:102112054-102112076 GTGGGGGTGGGGTGGGGAGTGGG + Intronic
959899871 3:111648739-111648761 GAGTGGGTAGTGGGGGAAGGAGG - Intronic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960338354 3:116445590-116445612 GTGGGGGGAGGGTGGGGGGGTGG - Intronic
960586567 3:119325650-119325672 GCGGGGGTTGGGGGGGAAGGGGG + Intronic
960590767 3:119363393-119363415 GTGGGAGTAGGGTGTGATGGGGG - Intronic
960684212 3:120280698-120280720 GTGTGAGTAAGGAGAGAAGGTGG - Intronic
960692662 3:120363183-120363205 GTGTGTGTGTGGTGGGGAGGAGG + Intergenic
960871569 3:122254943-122254965 GGGTGGGGAGGGTGGCAAGGGGG - Intronic
960923665 3:122774637-122774659 GTGTGGGAAGGGAGGGCAAGGGG + Intronic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
961658941 3:128458181-128458203 GTGTGAGTAGGAAGGGGAGGAGG + Intergenic
961999939 3:131285282-131285304 GAGTGGGTAGAGAGAGAAGGTGG + Intronic
962229137 3:133645613-133645635 TTGTTGGTAAGATGGGAAGGAGG + Intronic
962276185 3:134015430-134015452 CTGGGGGTGGGGTGGGAGGGGGG + Intronic
962361648 3:134748114-134748136 GTGGGGGTAGGGTGGGAGTTAGG + Intronic
962423613 3:135249654-135249676 GTGAGGGTGGGATGGGGAGGTGG + Intronic
962711678 3:138091630-138091652 GTGGGGGGAGGGAGGGAGGGAGG + Intronic
963215023 3:142735790-142735812 GTGTTGGGAGGGTGGGAAGTAGG + Intronic
963327338 3:143877114-143877136 GTGTGGGGAGGGGGAGGAGGGGG - Intergenic
963669324 3:148231859-148231881 GGGTGGGTGGGGTGGCATGGGGG + Intergenic
964850537 3:161091511-161091533 GTGTGGATACGCTGGGAAGAGGG - Intronic
965603162 3:170474429-170474451 GTGAAGGTAGAGTGTGAAGGTGG - Intronic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965903688 3:173675684-173675706 GTGTGGGTTGGGAAGAAAGGAGG + Intronic
966091030 3:176136551-176136573 GGGGGTGGAGGGTGGGAAGGTGG - Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
967116483 3:186344590-186344612 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
967538597 3:190637777-190637799 GTTTGGGGAGGTGGGGAAGGTGG - Intronic
967803423 3:193690307-193690329 GTGTGTGTGGGGTGGGGTGGGGG - Intronic
967849535 3:194071397-194071419 GCGTGGGGAAGGCGGGAAGGCGG - Intergenic
967877252 3:194275752-194275774 GTGGGGGTAGGGTGGGGGTGGGG + Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
967963421 3:194942618-194942640 GTGTGGGTAGCCTGGGAACCTGG + Intergenic
967967459 3:194973465-194973487 CTGTGGGTGGGGTGGGATGGGGG - Intergenic
968045912 3:195623886-195623908 GTGGGGGTGGGGTTGGAGGGTGG + Intergenic
968074732 3:195810100-195810122 GTGTGGCCAGGGTGGGGTGGGGG + Intronic
968120326 3:196121449-196121471 GTGTAGGTCTGGTGGGTAGGGGG - Intergenic
968308742 3:197666201-197666223 GTGGGGGTGGGGTTGGAGGGTGG - Intergenic
968356047 3:198108149-198108171 GCGGGGGTAGGGAGGGAGGGAGG + Intergenic
968434225 4:576492-576514 GCGCGGATAGGGAGGGAAGGCGG - Intergenic
968613856 4:1568710-1568732 GTGCGGGTGGGGTGGGTGGGAGG - Intergenic
968626272 4:1628020-1628042 GGGTGGGGAGGGTGGCACGGGGG + Intronic
968669902 4:1843654-1843676 GCCTGGGAGGGGTGGGAAGGGGG + Intronic
968969753 4:3787722-3787744 GTCTGGGGAGGGTGGCGAGGAGG + Intergenic
969327945 4:6454496-6454518 GGGTGGGGAGAGTTGGAAGGCGG - Intronic
969431791 4:7159418-7159440 GTGGGGGCAGGGTGGGAGTGGGG - Intergenic
969533586 4:7742252-7742274 GTGTGGGTGGGGTGGCCAGCAGG - Exonic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
969803293 4:9586586-9586608 ATGTGGGTTGGGTGGGCTGGAGG + Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970813994 4:20131424-20131446 GTGAGGATGGAGTGGGAAGGTGG + Intergenic
971232199 4:24808890-24808912 GTGCTGGTAGGCTGGGCAGGAGG - Intronic
971327904 4:25658905-25658927 GTGGGGGTGGGGTGGGTGGGTGG - Intronic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
972789348 4:42355993-42356015 GTGTGAGAAGAGTGGGGAGGAGG + Intergenic
973088501 4:46100321-46100343 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
973173477 4:47174855-47174877 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
973180213 4:47257548-47257570 GTGGGTGTAGGGAGGGAGGGTGG + Intronic
973570479 4:52233939-52233961 GTGTGTGTGGGGGGGGGAGGGGG + Intergenic
973792102 4:54387486-54387508 TTGGGGAAAGGGTGGGAAGGGGG - Intergenic
973845756 4:54911507-54911529 GTGTGGGTATGGTGGAGAAGGGG - Intergenic
974272161 4:59664501-59664523 GTGTGGGTAACGGGGAAAGGAGG - Intergenic
975539494 4:75491540-75491562 GTGTGTGTGGTGTGGGGAGGTGG - Intronic
975921956 4:79401725-79401747 TTCTGAGTAGGGTGGGGAGGGGG + Intergenic
975997111 4:80328497-80328519 GTGTGGGTAGGTAGGGGTGGGGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976525649 4:86084214-86084236 GTGTGGGTAGAGTGCCAAGCAGG + Intronic
976556180 4:86453568-86453590 GTGGGGGTGGGGTGGGGGGGTGG - Intronic
976806068 4:89048457-89048479 GTGGGGGTGGGGAGGGATGGTGG + Intronic
976897349 4:90128007-90128029 TTGCGGGCGGGGTGGGAAGGAGG + Intronic
977039497 4:91997980-91998002 GTGTTGATAGGGTGGGGATGAGG + Intergenic
977287485 4:95126682-95126704 ATGGCGGTAGGATGGGAAGGAGG + Intronic
977631903 4:99252376-99252398 GGGAGGGTAGTTTGGGAAGGAGG + Intergenic
977987565 4:103401854-103401876 GTGTAGGTGGGGTGGGGTGGGGG + Intergenic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978243804 4:106548836-106548858 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
978370339 4:108023570-108023592 GTATGGGTAGCTTGGGAAGGAGG + Intronic
978629420 4:110726414-110726436 GTGTGGGTAGAGTGGAGAGTGGG + Intergenic
979223907 4:118263794-118263816 CTGGGAGTAGAGTGGGAAGGTGG - Intergenic
979298021 4:119054671-119054693 GTGTGGGTGGGGTGGGCCGCAGG + Intronic
979473824 4:121131628-121131650 GTGTGGAGTGGGTGGGTAGGGGG + Intronic
979813891 4:125074244-125074266 AGGGGGATAGGGTGGGAAGGGGG + Intergenic
980194762 4:129574197-129574219 ATGAGGAAAGGGTGGGAAGGAGG - Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
980524077 4:133966801-133966823 TTGGGGGTAGGGTGGGAGTGGGG + Intergenic
980735201 4:136876355-136876377 GTCTGGGAAGGTTAGGAAGGGGG + Intergenic
981536152 4:145801924-145801946 GGGTGGGGAGGGCAGGAAGGTGG + Intronic
981713934 4:147733985-147734007 ATGTGTGTTGGGTGGGAAGTAGG + Intronic
982334577 4:154219921-154219943 GTGGGAGGAGGGAGGGAAGGAGG - Intergenic
982380434 4:154743129-154743151 GTGTGTGTAGGGCGGGGGGGGGG - Intronic
982584787 4:157222470-157222492 GTGGGGGTGGGGCGGGGAGGCGG + Intronic
983074953 4:163314863-163314885 GATGGGGGAGGGTGGGAAGGAGG - Intergenic
983203692 4:164889166-164889188 GTGAGGGTGGGGTGGGAGTGGGG + Intronic
983462534 4:168046481-168046503 GTGGGGGTAGGGAGGGAGAGAGG - Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
983622708 4:169776683-169776705 GTGTGGGCGGGGTGGGGGGGTGG - Intergenic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
983804183 4:171973075-171973097 GTGTGTGTATGTTGGGGAGGAGG - Intronic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
983929134 4:173434120-173434142 ATGGGGCCAGGGTGGGAAGGTGG + Intergenic
984508698 4:180653356-180653378 GTGGGTGGAGGGTGGGAAGAGGG + Intergenic
984768580 4:183418829-183418851 GTGTTGATAGTGTGGCAAGGGGG - Intergenic
984910285 4:184668045-184668067 GTGAGGATAGAGTGGGAAGAGGG - Intronic
984935313 4:184884389-184884411 ATATGGGGAGGGTGGGGAGGCGG + Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985485509 5:146268-146290 GTGTGGGAAAGGAGGGAGGGGGG - Intronic
985680263 5:1252496-1252518 GGGTGGGTAGGGTGGGGCAGTGG - Intergenic
985697074 5:1346655-1346677 ATGGGGGTAGGGTGGTAGGGAGG - Intergenic
985905441 5:2831507-2831529 GTGTGCGGTGGGTGGGAGGGAGG + Intergenic
985973991 5:3400895-3400917 GAGTGGGAAGCGTGTGAAGGAGG - Intergenic
986106800 5:4667494-4667516 AGGTGGGTAGGGTGGGAAAGGGG + Intergenic
986452977 5:7884663-7884685 GGGTGTGGAGGGTAGGAAGGGGG - Intronic
986495076 5:8333213-8333235 GAGTGGGTAGGGAGGGAGTGAGG + Intergenic
986624708 5:9712914-9712936 GTGTGAGGAAGGTGGGAGGGTGG - Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
986930347 5:12811508-12811530 GTGGGGGTAGGGTGGTAAATGGG - Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
987091169 5:14509048-14509070 GGGTGGGTAGGGGAGGCAGGTGG - Exonic
987409920 5:17604610-17604632 GTGTGGGAAGGGGAGGCAGGGGG + Intergenic
987702985 5:21425960-21425982 GAGTGGGGAGGGTGGGAGGAAGG - Intergenic
987762590 5:22184995-22185017 GAGAGGGTAGGGTGGGAGAGGGG - Intronic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
988868029 5:35356739-35356761 GTGAGGGTAGGGTGAAAAAGTGG - Intergenic
989142298 5:38213663-38213685 GCGCGTGTAGGGTGGGAAGGGGG + Intergenic
989370877 5:40706326-40706348 GAGTGGGGAGGGTGGCAGGGGGG + Intergenic
989563498 5:42877348-42877370 GTGTAGGTTGGGGAGGAAGGAGG - Intronic
989667646 5:43874645-43874667 GTGGAGATAGGGTGGGATGGGGG + Intergenic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990324505 5:54661495-54661517 GTGAAGGTGGGGTGGGTAGGGGG + Intergenic
990331378 5:54729633-54729655 GTGGGGGTGGGGTGGGGGGGGGG - Intergenic
990446189 5:55896589-55896611 GTGGGGGAAGGGAGGGGAGGGGG - Intronic
990874007 5:60464033-60464055 GTGTGTGTGGGATGGGGAGGGGG - Intronic
991240875 5:64458705-64458727 GTGTGGCTATGGTGGGATGCTGG - Intergenic
991659704 5:68938015-68938037 GTCGGGGTGGGGTGGGAAGAGGG - Intergenic
991897381 5:71418380-71418402 GAGAGGGTAGGGTGGGAGAGGGG - Intergenic
992037394 5:72793775-72793797 GTATGGGTGAGGTGGGTAGGAGG - Intergenic
992135115 5:73736840-73736862 GTGAGGGGAGGGAGGGAGGGAGG + Intronic
992551764 5:77866268-77866290 GAGTGGGGCGGGTGGGAGGGAGG + Intronic
992617203 5:78556048-78556070 GTGTGGGTGAGGTGGGACAGGGG + Intronic
993045277 5:82859323-82859345 GTGTGTGTATGTTGGGAGGGAGG - Intergenic
993256452 5:85596699-85596721 TTGTGGGCAGTGTTGGAAGGTGG + Intergenic
993930861 5:93937271-93937293 GTGTGGGTGGGGGGAGGAGGAGG + Intronic
994299309 5:98127377-98127399 GTGGGGGTAGGGTGGAGAGAGGG + Intergenic
994328319 5:98475550-98475572 TTGTGGGGAGGTTGGGGAGGAGG - Intergenic
994535972 5:101029800-101029822 GAGAGGGGAGGGTGGGAGGGAGG + Intergenic
994703721 5:103172482-103172504 GTGGGGGTAGAGTGGGAAAGAGG - Intronic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
995173243 5:109142132-109142154 GTGAAGATAGAGTGGGAAGGAGG + Intronic
995245718 5:109933001-109933023 GTGTGTGTATGATGGGAATGGGG + Intergenic
995248966 5:109967401-109967423 GTGTTGGGAGTGTGGGAAGATGG - Intergenic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
995317040 5:110787116-110787138 GTGTGTGTTGGGGGGAAAGGAGG - Intergenic
995550802 5:113279228-113279250 ATGTGGGTTGGGTGGGAAACTGG - Intronic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996307160 5:122060404-122060426 GTGTGGGTGTGATGGGAAAGTGG - Intronic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996608597 5:125352644-125352666 TTGGGGGGAGGGTGGGGAGGGGG - Intergenic
997196128 5:131981121-131981143 GTGTGGGTGGGGGAGAAAGGAGG - Intronic
997643895 5:135467499-135467521 CAGAGGGTAGGGTGGGGAGGAGG + Intergenic
997722087 5:136087418-136087440 GGGTGGGTAGAGTTGGAAGGTGG + Intergenic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998103479 5:139453955-139453977 GTGTGTGTAGTGTGGGATGTGGG + Intronic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998187514 5:139993114-139993136 GTGTGTGTGTGGTGGGGAGGGGG + Intronic
998565576 5:143213333-143213355 GTATGGGGAGTGTGGGGAGGAGG - Intronic
998959149 5:147466420-147466442 GTGAGGGTGGGCTGGAAAGGAGG - Intronic
999143453 5:149377797-149377819 GTGTGGGAGGGGTGGGTTGGGGG + Intronic
999233397 5:150076213-150076235 ATGTGGGTTGGGTGGGAACCTGG - Intronic
999671721 5:153964536-153964558 GCCTGGGGAGGGTGGGGAGGTGG + Intergenic
999731463 5:154478962-154478984 GTAGGGGTGGGGCGGGAAGGAGG + Intergenic
999982872 5:156974860-156974882 GTGGGGGGAGGGAGGGAGGGAGG + Intergenic
1000227856 5:159285185-159285207 GTGTGTGTGTGGTGGGAGGGTGG - Exonic
1000613702 5:163404629-163404651 GTGTGTGTAAGGAGGGAGGGGGG - Intergenic
1000840502 5:166212111-166212133 CTGTTGGTAGAGTGGGGAGGTGG - Intergenic
1001106613 5:168859972-168859994 GTGTGGATAGGTAGGGAAAGAGG - Intronic
1001231672 5:169994086-169994108 GTGGGTGTAGGGAGGGCAGGTGG + Intronic
1001273236 5:170331580-170331602 GTGTGGATGGTGTGGGGAGGTGG + Intergenic
1001273240 5:170331589-170331611 GTGTGGGGAGGTGGGGAAGGAGG + Intergenic
1001681125 5:173557622-173557644 GTGTGTGTATGGGGGGCAGGGGG + Intergenic
1001731666 5:173964624-173964646 GTGGGGTGAGGGTGGGAATGTGG + Intergenic
1002400501 5:178989201-178989223 GGGTGGTGAGGGTGGGGAGGGGG - Intronic
1002460043 5:179368811-179368833 GTGTGGCCAGGGTGAGGAGGCGG - Intergenic
1002476152 5:179467558-179467580 GTGTGGGCGTGTTGGGAAGGTGG - Intergenic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1002759913 6:193186-193208 TTCTCGGTAGGGTGGGATGGTGG + Intergenic
1002772877 6:304321-304343 GTGGGGCCAGGGTGGGCAGGCGG + Intronic
1002987582 6:2205769-2205791 GTGTGTGTGGGGGGGGAGGGGGG + Intronic
1003563251 6:7201508-7201530 CAGTGGGGAGGGTGGGATGGGGG - Intronic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1003872204 6:10412419-10412441 GAGAGGGGAGGGAGGGAAGGAGG + Intronic
1004072592 6:12314520-12314542 GTGTGGGAGGGTGGGGAAGGAGG - Intergenic
1004303434 6:14478641-14478663 GTGTGGGTAGGGGAGGAGAGGGG + Intergenic
1004541996 6:16559967-16559989 GTGATGGTGGGGTGGGGAGGCGG - Intronic
1004558652 6:16725974-16725996 ATGTGGGTATTGTGGGGAGGAGG - Intronic
1004570540 6:16840389-16840411 GTGGGGGTGGGGAGGGAAAGTGG + Intergenic
1004580486 6:16946485-16946507 GTGTGGCTAAGGAGGCAAGGTGG + Intergenic
1004652273 6:17621701-17621723 GTGGTGGTAGGAAGGGAAGGTGG + Intronic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1005697828 6:28367627-28367649 GTGTGTGTTGGGTGGTAGGGTGG - Exonic
1005712561 6:28515858-28515880 GTGTGTGTAGGGAGTGGAGGTGG - Intronic
1005865093 6:29931373-29931395 GTGGGGGGAGGGAGGGAGGGAGG + Intergenic
1005979739 6:30827827-30827849 GTGGGGGGTGGGTGGCAAGGGGG + Intergenic
1006106381 6:31719367-31719389 GGGTGGATGGGGTGGGGAGGTGG - Intronic
1006268691 6:32947597-32947619 GTGGGTGTAGAGTGGTAAGGGGG + Intronic
1006530403 6:34647498-34647520 TTGCGGATAGGATGGGAAGGAGG + Intronic
1006605018 6:35249845-35249867 GTGTGGACAGGGTGGGCAGGAGG - Exonic
1006894727 6:37460273-37460295 GTGTGGCTAGTGAAGGAAGGTGG + Intronic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1006989682 6:38203739-38203761 GGGTGGGAAGGGTGTGAAGGTGG + Intronic
1007183502 6:39947941-39947963 GTGTAGGGAGGGAGGGAGGGGGG + Intergenic
1007325723 6:41058138-41058160 GTGTGTGTGGGGTGGGGTGGTGG - Intronic
1007395495 6:41575534-41575556 TTGTGGGTAGGGGGTGTAGGGGG + Intronic
1007415010 6:41686466-41686488 GTCTTGGTAGTCTGGGAAGGAGG - Intronic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007599121 6:43070918-43070940 GTGGGGGGAGGGGGGGCAGGCGG + Intronic
1007760979 6:44133646-44133668 GAGTGGATGGGGTGGGCAGGAGG - Intronic
1008267389 6:49445505-49445527 CTGTGGATAGGGTGGGCAGTGGG - Intronic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008416239 6:51244070-51244092 GGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1008449058 6:51628219-51628241 GAGTGGGGAAGGTGGGAGGGGGG - Intronic
1008883880 6:56410931-56410953 GTGTGTGTGGGGTGGGGGGGGGG - Intergenic
1008888423 6:56456904-56456926 ATGTGTGTAGGGTGGGGAAGAGG + Intergenic
1008964855 6:57304603-57304625 GTGTGGGTTAGGTGAGGAGGAGG + Intergenic
1009560828 6:65240427-65240449 GAGAGGGTTGGGAGGGAAGGAGG - Intronic
1009869770 6:69439685-69439707 TTGTGGGGTGGGTGGGAGGGGGG - Intergenic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010659939 6:78557625-78557647 GTGTGGGGCAGGTGGGAAGGGGG - Intergenic
1010686527 6:78859937-78859959 GTGTGTGGAGGTAGGGAAGGCGG - Intergenic
1010759434 6:79706089-79706111 GTCTGGGTTGGGGGGCAAGGTGG - Intergenic
1011016410 6:82760605-82760627 GTGGGGGAAGTGTGGGAGGGAGG + Intergenic
1011196756 6:84788478-84788500 ATGGGGAAAGGGTGGGAAGGGGG + Intergenic
1011231440 6:85166018-85166040 GTGGGGGTAGGGTGGGGGAGTGG - Intergenic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1011277234 6:85643079-85643101 GTGGTGGTAGGGGGAGAAGGAGG - Exonic
1011493377 6:87915352-87915374 GTGTGTGGAGGGTGGGAGGTGGG + Intergenic
1012027777 6:94019901-94019923 TTGGGGAAAGGGTGGGAAGGGGG - Intergenic
1012288467 6:97422264-97422286 GGGTGGGGAGGGTGGGGAGGTGG - Intergenic
1012950163 6:105509738-105509760 GTGTGTGTGGGGTGGGGAGGTGG + Intergenic
1013050982 6:106534817-106534839 GTGTGTGTAGGGGTGGAAGTGGG + Intronic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013739111 6:113262718-113262740 GAGAGGGTAGGAAGGGAAGGGGG + Intergenic
1014622688 6:123688582-123688604 GTGGGTGAAGGGTGGGAAGAGGG + Intergenic
1014726464 6:124977624-124977646 GTTTGCTTAGGGTGGTAAGGAGG + Intronic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015480244 6:133700634-133700656 GATTGGGGAGGGTGGGAGGGAGG - Intergenic
1015585809 6:134775103-134775125 GAGTGTGTAGGGTGGGGAAGTGG - Intergenic
1015767756 6:136737235-136737257 GAGACGGGAGGGTGGGAAGGGGG + Intronic
1015841770 6:137484755-137484777 GTGAGGGGAGGGTGGGAGTGGGG + Intergenic
1015868785 6:137754489-137754511 GTGTGGGTAATGTGGGGGGGTGG - Intergenic
1015890890 6:137968595-137968617 GTGTAGGGAGAGGGGGAAGGAGG + Intergenic
1016271976 6:142300938-142300960 GGGTGCGGGGGGTGGGAAGGAGG - Intergenic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1016451026 6:144182407-144182429 GTGTGGTAAAGGAGGGAAGGGGG - Intronic
1016586248 6:145689966-145689988 CTGATGGTCGGGTGGGAAGGAGG - Intronic
1016893653 6:149032231-149032253 GTGGTGGTAGGATGGGAAGAGGG - Intronic
1017460717 6:154646808-154646830 GTGGGGGTAGGGAGTGGAGGGGG + Intergenic
1017754555 6:157518392-157518414 GTGGGGGGAGGGTGGAAGGGGGG + Intronic
1017759369 6:157556254-157556276 GGGGGTGGAGGGTGGGAAGGGGG + Intronic
1017824874 6:158074090-158074112 GACTGGGCAGGATGGGAAGGAGG + Intronic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1017963922 6:159247219-159247241 GGGTGGGGAGGGAGGGAACGGGG - Intronic
1018690081 6:166337579-166337601 GTGTGGGTGAGGTGGTTAGGGGG - Intronic
1018891442 6:167986017-167986039 GGGAGGCTGGGGTGGGAAGGAGG - Intergenic
1018900548 6:168049751-168049773 GTGGGGGTGGGGTGGGGTGGGGG + Intergenic
1019059083 6:169242795-169242817 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059106 6:169242861-169242883 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059165 6:169243042-169243064 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059182 6:169243092-169243114 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019410326 7:903965-903987 GGCTGGGCAGCGTGGGAAGGCGG - Intronic
1019706618 7:2500014-2500036 GGGTGGGTGGGGTGGCCAGGGGG - Intergenic
1020016730 7:4835763-4835785 GCGGGGGTAGGGTGAGCAGGGGG + Intronic
1020441522 7:8221890-8221912 GTGGGGGTAGGGACGGAGGGTGG + Intronic
1020899537 7:13988542-13988564 GTGGGGGTGGGGTGGGGAGGAGG - Intronic
1021056458 7:16053316-16053338 GTGTGGGTAGGGGTGGGAGGTGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021734149 7:23626649-23626671 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1022091974 7:27113856-27113878 GGGTGGGGTGGGTGGGAGGGGGG - Intronic
1022091978 7:27113860-27113882 GGGTGGGTGGGGTGGGTGGGAGG - Intronic
1022132795 7:27419423-27419445 GTCTTGGCATGGTGGGAAGGTGG - Intergenic
1022367362 7:29736351-29736373 GTTAGGGTGGGGTGGGAATGTGG + Intergenic
1022522842 7:31019144-31019166 GTGTGGGTAGGGCAGGAGGGAGG + Intergenic
1022657603 7:32334581-32334603 GGGGGGGGAGGGTGGGAGGGCGG - Intergenic
1023565146 7:41516684-41516706 GTGGGAGTAGGGCAGGAAGGTGG - Intergenic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1023722849 7:43113308-43113330 GTGGGTGTGGGCTGGGAAGGGGG - Intronic
1024054106 7:45648520-45648542 GTGTGGCCTGGGCGGGAAGGTGG + Intronic
1024257549 7:47549925-47549947 GTGGGGATGGGGTGGGAGGGCGG - Intronic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1024392779 7:48834484-48834506 GTGTCGGGGGTGTGGGAAGGTGG + Intergenic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1024518865 7:50285154-50285176 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1024525254 7:50343158-50343180 GGGAGGGTGGGGAGGGAAGGAGG - Intronic
1024969930 7:55059627-55059649 GTTTGGGGAGGGTGGGAAGGAGG - Intronic
1026605920 7:71815778-71815800 GGGTGGGAAGGGAGGAAAGGGGG - Intronic
1026767770 7:73171381-73171403 GGGTGGGCTGGGTGGGAGGGGGG - Intergenic
1026919388 7:74144185-74144207 GAGTGGGCAGGAGGGGAAGGAGG - Intergenic
1026969081 7:74457093-74457115 GTGAGGCTGGGGTGGGAGGGTGG - Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027044237 7:74981089-74981111 GGGTGGGCTGGGTGGGAAGGGGG - Intronic
1027079405 7:75221269-75221291 GGGTGGGCTGGGTGGGAGGGGGG + Intergenic
1028104775 7:86864170-86864192 CGGGGGGAAGGGTGGGAAGGAGG - Intronic
1028239062 7:88397459-88397481 GTGAGGATAGAGTGAGAAGGTGG + Intergenic
1028355814 7:89906097-89906119 GTCTGGGGAGGGTGGTGAGGAGG - Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028647948 7:93119515-93119537 GTGTGGGTTGTGTGGAAATGGGG + Intergenic
1028662618 7:93297760-93297782 GTTTGGGTAGTGGAGGAAGGTGG + Intronic
1028774386 7:94660812-94660834 GGGTGGGGAGGGTGGTAAGGGGG + Intronic
1028784051 7:94772283-94772305 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1029053657 7:97717046-97717068 GCGGGGGAAGGGTGGGAAGGGGG + Intergenic
1029069457 7:97883411-97883433 ATGTGGGTTGGGTGGGCTGGAGG - Intergenic
1029150134 7:98474384-98474406 GTGGGGGTGGGGTGGGGTGGGGG + Intergenic
1029221752 7:98995688-98995710 GTGTGTGTATGATGGGATGGGGG - Intronic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029472019 7:100760603-100760625 GAGTGGGCAGGGTGGGCAGCAGG - Intronic
1029551492 7:101239234-101239256 GGGAGGGGAGGGTGGGGAGGAGG + Intergenic
1029577273 7:101411795-101411817 GTGTGGTTCTGGTGGAAAGGAGG + Intronic
1029743091 7:102502284-102502306 GGGGGGGAAGGGCGGGAAGGGGG + Intronic
1029761081 7:102601445-102601467 GGGGGGGAAGGGCGGGAAGGGGG + Intronic
1029824931 7:103181224-103181246 GTTAGGGTGGGGTGGGAATGTGG - Intergenic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1031107682 7:117565547-117565569 GGGTGGGGAGAGTGAGAAGGAGG + Intronic
1031384715 7:121134452-121134474 GGGAGGGTAGGAAGGGAAGGAGG + Intronic
1031484741 7:122312837-122312859 GTCGGGGGAGGGGGGGAAGGGGG - Intergenic
1031638292 7:124129339-124129361 GTGTGGGGAGGAGGGGAGGGGGG - Intergenic
1031681481 7:124680628-124680650 GAGAGGATAGAGTGGGAAGGGGG - Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1031866152 7:127040036-127040058 GGGTGAGGAGGGTGGGGAGGAGG + Intronic
1031898272 7:127379842-127379864 GTGTGGGGGGGGTGGGGGGGTGG - Intronic
1032392200 7:131562604-131562626 GTGTGGATGGGAAGGGAAGGAGG + Intergenic
1032408484 7:131675130-131675152 GTGTGTGTAAGATGGGCAGGAGG - Intergenic
1033363140 7:140652054-140652076 GTGAGTGTGGGGTGGGAAGAGGG + Intronic
1033718135 7:144024513-144024535 GAGTGGCTTGGGTGGGAAGAGGG - Intergenic
1033943242 7:146681513-146681535 GGGTGGGAGGGGTGGGAGGGTGG + Intronic
1034030902 7:147762722-147762744 GTGGGGGGAGGGAGGGAGGGAGG + Intronic
1034131084 7:148718377-148718399 TTGTGGGGATGGTGGGAATGGGG - Intronic
1034316490 7:150137895-150137917 GTATTTGTGGGGTGGGAAGGTGG + Intergenic
1034381978 7:150705150-150705172 GAGTGGGGAGGGTGGGAAGGGGG + Intergenic
1034790370 7:153962782-153962804 GTATTTGTGGGGTGGGAAGGTGG - Intronic
1034914368 7:155024643-155024665 GTGAGGGTAGAGTGAGAAGCTGG + Intergenic
1034938042 7:155212330-155212352 GGGTGGGTGGTGTGGGGAGGTGG + Intergenic
1035242167 7:157539376-157539398 CTGTGGGAAGGGCGGGATGGAGG + Exonic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1035695287 8:1591321-1591343 ATGTGGGCCAGGTGGGAAGGAGG + Intronic
1036251699 8:7168077-7168099 ATGTGGGTTGGGTGGGCTGGAGG - Intergenic
1036301974 8:7574824-7574846 GGGTGGGGACGGGGGGAAGGGGG - Intergenic
1036365792 8:8119384-8119406 ATGTGGGTTGGGTGGGCTGGAGG + Intergenic
1036384937 8:8270615-8270637 CTGTGGGTAGGGTGGGGCAGAGG - Intergenic
1036579640 8:10061999-10062021 GTGGGGGAAGGGAGGAAAGGAGG + Intronic
1036678424 8:10853176-10853198 GTGTGGGAGGGCAGGGAAGGTGG + Intergenic
1036900857 8:12668045-12668067 TGGTGGGTGGGGTGGGTAGGAGG - Intergenic
1037157917 8:15728447-15728469 GTGTGGAGAGGGAGGGAGGGAGG + Intronic
1037169402 8:15873879-15873901 GGGTAGGAAGGGTAGGAAGGGGG - Intergenic
1037338877 8:17820677-17820699 GTGTGTGTAGAGGGGGAGGGAGG - Intergenic
1037892290 8:22629713-22629735 TGCTGGGTGGGGTGGGAAGGGGG + Intronic
1037909230 8:22733790-22733812 GTTTGGGGAGGGTGGGGATGGGG + Intronic
1038011688 8:23481249-23481271 GGTGGGGTAGGGTGGGAAAGAGG - Intergenic
1038054170 8:23842672-23842694 GGGTGGGAAGTGTGGGAGGGAGG + Exonic
1038229121 8:25684361-25684383 GTTTGGGCAGGGTGGGGTGGGGG + Intergenic
1038350435 8:26771466-26771488 GTTTGGGTAGGTAGAGAAGGTGG - Intronic
1038372350 8:27006825-27006847 GTCTGGGAGGGGTGGGGAGGAGG + Intergenic
1038533822 8:28339588-28339610 GTGTGTGTGGAGTGGGGAGGGGG - Intronic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039116228 8:34094264-34094286 GTGTAGTTAGGGTGAGAATGAGG - Intergenic
1039415879 8:37393726-37393748 CTTTGGGAAGGGTGGGAAGCTGG - Intergenic
1039418804 8:37418795-37418817 GTGTGGCTGGGGTGAGGAGGAGG - Intergenic
1039538911 8:38345287-38345309 GAGGGGGTAGGATGGAAAGGGGG + Intronic
1039567538 8:38562083-38562105 GTGTGTGTAAGGTGGGATGGGGG - Intergenic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040325301 8:46338576-46338598 GTGTGGTGTGGGTGGGATGGAGG + Intergenic
1040392290 8:46960618-46960640 ATGGGGAAAGGGTGGGAAGGGGG - Intergenic
1040442326 8:47456753-47456775 GTTGGGGAAGGGTGGGAAGTGGG - Intronic
1040629260 8:49190797-49190819 GAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1040812830 8:51475769-51475791 GTGAGGGAAGGGAGGGAGGGGGG - Intronic
1040839799 8:51772683-51772705 CTGTGTGGAAGGTGGGAAGGAGG + Intronic
1040866336 8:52052298-52052320 GGGTGGGGAGGGAAGGAAGGGGG - Intergenic
1040964004 8:53065684-53065706 GCTTGGCTTGGGTGGGAAGGGGG - Intergenic
1041212785 8:55569435-55569457 GGGTGGCTAGGGTTGGAAAGAGG + Intergenic
1041242599 8:55861046-55861068 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1041627873 8:60051814-60051836 CTGTGAGTGGGGTGGGAAGTGGG - Intergenic
1041714119 8:60918195-60918217 GTGTGTGTATGGTGGGGAGGGGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1041775140 8:61514961-61514983 GGGTGGACAGGGAGGGAAGGAGG + Intronic
1041799976 8:61788090-61788112 CTATGGGTGGGGTAGGAAGGGGG + Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042448841 8:68921277-68921299 GTGTGTGTATGGTGGGGGGGGGG + Intergenic
1042636613 8:70883123-70883145 GTTGGGGGAGGTTGGGAAGGGGG - Intergenic
1042680889 8:71381769-71381791 GTGTGTGTAGGGGTGGGAGGGGG - Intergenic
1042921680 8:73926195-73926217 TGGTGGGTAGGGTGGCAAGCTGG - Intergenic
1042995070 8:74688806-74688828 GTGGGGAAAGGGTGGGATGGGGG - Intronic
1043816390 8:84807155-84807177 GGGTGGGAAGGTTGGGAGGGGGG - Intronic
1044013652 8:87025067-87025089 GTCTGGGTAGGGTGGGGACTTGG + Intronic
1044036218 8:87306755-87306777 GTGGGGGAAGAGTGGGAGGGGGG + Intronic
1044255322 8:90053487-90053509 GTGAGAGGTGGGTGGGAAGGTGG - Intergenic
1044379535 8:91517929-91517951 ATGAGGGTGGGGTGGGAAGTGGG - Intergenic
1044495488 8:92875175-92875197 GTGTGTGTGGGGTGGGATCGGGG - Intergenic
1045085768 8:98682866-98682888 GTGTGCATAGGGTAGGAAGGTGG - Intronic
1045288384 8:100811424-100811446 TGGGAGGTAGGGTGGGAAGGTGG - Intergenic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1046166405 8:110442145-110442167 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
1046175178 8:110566421-110566443 GATTGGGTAGAGTGGGAAGCTGG - Intergenic
1047237486 8:123054836-123054858 TGGGGGGAAGGGTGGGAAGGGGG + Intronic
1048056995 8:130876705-130876727 GTGTGTGTAGGGGGGCAGGGGGG + Intronic
1048209567 8:132443547-132443569 GTGTGGGTAGTGGGGGATGATGG - Intronic
1048314112 8:133349572-133349594 GTGAGGGAAGGGAAGGAAGGGGG + Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048408819 8:134150679-134150701 GGGAAGGTAGGGTGGGGAGGTGG - Intergenic
1048443346 8:134476168-134476190 GTGTGGGTGGGGCAGGCAGGAGG - Intergenic
1048545450 8:135382462-135382484 GAGGGTGGAGGGTGGGAAGGAGG - Intergenic
1048849929 8:138635155-138635177 TTGTTAGTAGGGTTGGAAGGTGG - Intronic
1049375061 8:142285438-142285460 GTGTGGGTGGGTGGGGTAGGTGG + Intronic
1049385527 8:142341245-142341267 GTGCAGGGAGGCTGGGAAGGGGG - Intronic
1049569860 8:143364334-143364356 GTGTGCTTAGGGAGGGAGGGAGG - Intergenic
1049773013 8:144392424-144392446 GTCTGGGGAGGGAGGGAGGGAGG - Exonic
1049844303 8:144792586-144792608 GTGTGCGTGGGCTCGGAAGGAGG + Exonic
1049895985 9:112861-112883 GTGTGGGAAGTGTGGGGAGTCGG - Intergenic
1050520878 9:6498518-6498540 GTAGGGGAAGGGTGGGGAGGTGG + Intronic
1050663461 9:7909017-7909039 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1051170279 9:14314178-14314200 GTGGGGGCGGGGTGGGATGGGGG + Intronic
1051276284 9:15402060-15402082 GTTTGTGTAGGGTGGGTAGTAGG - Intergenic
1051433054 9:17000052-17000074 GTGTGTGTAGGTGGGGAGGGTGG - Intergenic
1051604796 9:18908647-18908669 GTGTGTGTGGAGTGGGGAGGGGG - Exonic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052141894 9:24996094-24996116 GTCTGTGTAGGATGGGAAGGGGG + Intergenic
1052151906 9:25127424-25127446 GAGTGGGGAGGATGGGAAGAGGG + Intergenic
1052328873 9:27246948-27246970 GTGTGTGTGGGGTGGGGGGGGGG - Intergenic
1052861639 9:33441447-33441469 ATGTGGGTAGGGCTGGGAGGAGG - Exonic
1052880195 9:33597167-33597189 GGGTGGGTAGTGTGGGAAGTAGG + Intergenic
1052965229 9:34335570-34335592 GTGTGTATAGAGTGGGTAGGAGG + Intronic
1053165533 9:35841423-35841445 GGGGGCATAGGGTGGGAAGGAGG - Intronic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1053522190 9:38791491-38791513 GTGTGGAGGGGGTGGGAAGAAGG - Intergenic
1053665991 9:40317956-40317978 GGGTGGGTAGGGTGAGGAGTAGG + Intronic
1053915572 9:42943001-42943023 GGGTGGGTAGGGTGAGGAGTAGG + Intergenic
1054194416 9:62015955-62015977 GTGTGGAGGGGGTGGGAAGGAGG - Intergenic
1054377147 9:64457984-64458006 GGGTGGGTAGGGTGAGGAGTAGG + Intergenic
1054460073 9:65458085-65458107 GTGTGAGGCGGGTGGGAGGGGGG - Intergenic
1054518619 9:66058327-66058349 GGGTGGGTAGGGTGAGGAGTAGG - Intergenic
1054643991 9:67572735-67572757 GTGTGGAGGGGGTGGGAAGGAGG + Intergenic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1054880191 9:70136518-70136540 GTGTGGGAGGGGGTGGAAGGTGG - Intronic
1054941005 9:70741817-70741839 TTGGGGAAAGGGTGGGAAGGGGG + Intronic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055071084 9:72166411-72166433 GTGTGGGTGGGGTGGGGGTGGGG + Intronic
1055262165 9:74449954-74449976 GTGTGTGTCGGGTGGGGAGGCGG - Intergenic
1055403598 9:75950141-75950163 GTGTGGGGGGGGCGGGGAGGGGG + Intronic
1055522676 9:77097572-77097594 GTGGGGGTGGGGTGGGGGGGCGG - Intergenic
1056030886 9:82552209-82552231 GTGTGGGCAGGGTGGGGGTGGGG - Intergenic
1056262681 9:84864348-84864370 GTGGGGAAAGGGTGGGAGGGGGG + Intronic
1056298458 9:85217486-85217508 GTGGGGGTGGGGTGGGAGTGGGG - Intergenic
1056585894 9:87926863-87926885 GGGTGGGTAGGGTGGAGAGTAGG - Intergenic
1056610990 9:88126080-88126102 GGGTGGGTAGGGTGGAGAGTAGG + Intergenic
1056810182 9:89757914-89757936 GGGTGGCTGGGGTGGGGAGGGGG - Intergenic
1057117715 9:92541412-92541434 GTGTGGGCGGGGTGGGGAGGGGG - Intronic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1057750482 9:97788736-97788758 GAGTTGGAAGGGTGGGAGGGGGG - Intergenic
1057869888 9:98709280-98709302 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1057896656 9:98914614-98914636 GACTGGGAAGGGTGGGTAGGTGG - Intergenic
1057952202 9:99378053-99378075 GTGGGGGTAGTGTGGGGGGGTGG + Intergenic
1057977461 9:99621272-99621294 GGCTGGGAAGGGTAGGAAGGAGG + Intergenic
1058179459 9:101779139-101779161 GTGTGGGTGGGGGAGGAAGCTGG - Intergenic
1059065105 9:111075484-111075506 GTGTGTGTATGGTGGGAATTAGG - Intergenic
1059516544 9:114901045-114901067 GTGTGTGTGTGGTGGGGAGGTGG + Intronic
1059525972 9:114991286-114991308 GTGTGTGCAGGGTTGGTAGGAGG + Intergenic
1059667863 9:116466119-116466141 TTGCGGGGAGGGTGGGAAGCGGG + Intronic
1059950135 9:119453900-119453922 GTGTGTGTGGGGGGGGATGGGGG - Intergenic
1060254397 9:122014473-122014495 GAGTGGGGAAGGTGGGAAGGTGG - Intronic
1060512296 9:124242910-124242932 GTGTGGGAGGGGTGGGAGGCAGG - Intergenic
1061077242 9:128349037-128349059 GTTGGGGTTGGGTGGGAGGGTGG + Intronic
1061083258 9:128384902-128384924 GGGGAGGTAGGGAGGGAAGGAGG - Intronic
1061201471 9:129140789-129140811 GGTGGGGTAGGGTGGGGAGGTGG + Intronic
1061230923 9:129315425-129315447 GTGGGGGTGGGGTGGGGAGGTGG + Intergenic
1061256867 9:129458721-129458743 GTGGGGGTAGGGGGCGAAAGGGG - Intergenic
1061339207 9:129965767-129965789 GGGAGGGAAGGGAGGGAAGGAGG + Intronic
1061375619 9:130222756-130222778 GTGTGGTTAGGGGTGGCAGGAGG + Intronic
1061499585 9:130994173-130994195 GAGTGGGGAGGGTGGAAAAGGGG - Intergenic
1061623513 9:131826722-131826744 TTGTGTGTAGGGAGGGATGGGGG - Intergenic
1062010837 9:134265821-134265843 ATGAAGGTAGGGAGGGAAGGAGG - Intergenic
1062136406 9:134930743-134930765 GGGCGGGTAGGGGGGGGAGGCGG - Intergenic
1062155570 9:135046301-135046323 GTGGGGGCAGGGTGGGGATGAGG + Intergenic
1062188211 9:135229835-135229857 GTGTGCGCACGGTGGGAGGGAGG - Intergenic
1062272709 9:135717179-135717201 GTGTGTATAGGATGGGAGGGAGG + Intronic
1062415415 9:136446830-136446852 GAGCGGGTACGGTGGGAAAGGGG - Intronic
1062597337 9:137305192-137305214 GTGTCGGGAGCGTGGGAAAGAGG + Intergenic
1203474358 Un_GL000220v1:137895-137917 GTGGGGGTGGGGTGGGTTGGGGG + Intergenic
1185602316 X:1348841-1348863 GAGGAAGTAGGGTGGGAAGGAGG - Intronic
1185633487 X:1534849-1534871 GTGTGGGTAGGGTTGGAGGGAGG + Intronic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1185700498 X:2227734-2227756 GGGAGGGAAGGATGGGAAGGAGG + Intronic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297990 X:8169860-8169882 GTGTGGTGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186572840 X:10734387-10734409 GAGGGGGAAGGGTGGGAAGAGGG + Intronic
1186933254 X:14418272-14418294 TTGTGGGGAGGGGGGGGAGGGGG - Intergenic
1187636544 X:21235474-21235496 GAGGGGGTAGGGTGGGAGGATGG + Intergenic
1187837012 X:23442219-23442241 GGGTGGAAAGGGTAGGAAGGCGG + Intergenic
1187940621 X:24377395-24377417 GTGTGGGTGGGATGGCAAGTGGG - Intergenic
1188189307 X:27155446-27155468 GCCTTGGAAGGGTGGGAAGGTGG + Intergenic
1188282637 X:28289285-28289307 GTGACAGTTGGGTGGGAAGGTGG - Intergenic
1188350325 X:29122456-29122478 GTGTGGGTGGGGTGGGGGTGGGG - Intronic
1188469674 X:30524006-30524028 GGCTGGGAAGGGTGGGAGGGAGG - Intergenic
1188509902 X:30924270-30924292 GTAAGGGCAGGGTGGGGAGGTGG + Intronic
1188574903 X:31636190-31636212 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1189036183 X:37495709-37495731 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189037691 X:37509251-37509273 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189279617 X:39812023-39812045 GTGTGGGTAGGGGGAGGTGGGGG - Intergenic
1189360556 X:40347348-40347370 GGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1189865588 X:45323803-45323825 GAGTGGGAAGGGTGGGGATGGGG - Intergenic
1190465676 X:50723308-50723330 GTGGGGGGAGGGGGGGAGGGAGG + Intronic
1191817324 X:65260415-65260437 GAGGGTGTAGGGTGGGAAGAAGG + Intergenic
1192057379 X:67786428-67786450 GGGGGGGCAGGGTGGGGAGGAGG - Intergenic
1192184814 X:68939782-68939804 GCTTGGGTGGGGTGGGACGGGGG + Intergenic
1192185125 X:68941584-68941606 GCGGGGGTGGGGTGGGAAGCGGG - Intergenic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1193456621 X:81739061-81739083 GAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1193751306 X:85348437-85348459 GTGTTGGAAGGGTGGTAAAGTGG - Intronic
1194320433 X:92440300-92440322 GAGTGGGGAGGGAGGGAGGGAGG - Intronic
1194547219 X:95252124-95252146 GAGGGGAAAGGGTGGGAAGGAGG - Intergenic
1194766950 X:97852459-97852481 GTGGGGGTAGGGTGGGAAGTTGG + Intergenic
1194978653 X:100417630-100417652 GTGGGGGTGGGGTGGGAAGGAGG + Intergenic
1195401504 X:104465984-104466006 TTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195594600 X:106673673-106673695 GTGTGTGTGGGGGGGGATGGGGG - Intronic
1195624608 X:106995142-106995164 GGCTGGGAAGGGTGGGAGGGGGG - Intronic
1195938485 X:110147069-110147091 GTTTGGGGTGGGTGGGTAGGTGG + Intronic
1196124025 X:112081250-112081272 GTGTGTCTAGGGAGGGAGGGAGG + Intronic
1196204984 X:112929204-112929226 AGGTGGAAAGGGTGGGAAGGGGG + Intergenic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1196440927 X:115719580-115719602 GTTGGGGGAGGGTGGGAAGGAGG - Intergenic
1196976708 X:121166167-121166189 CTGAGGATAGGGTGGGGAGGAGG - Intergenic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197239024 X:124103563-124103585 TTGGGGGCAGGGTGGGAAGGGGG - Intronic
1197455197 X:126670468-126670490 GGGTGGGTAGGTGGGGAGGGAGG + Intergenic
1197785328 X:130192090-130192112 GTGGGGGTGGGGTGGGGACGGGG + Intergenic
1197800321 X:130340869-130340891 GTGGGGGTAGGGGGTGTAGGAGG - Intronic
1197830716 X:130639323-130639345 GTGTGGGTGGGGGGTGATGGTGG + Intronic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198435149 X:136609811-136609833 GTGTTGGTGGGGCAGGAAGGTGG + Intergenic
1198719632 X:139602255-139602277 GTGTGTGTTGGGGGGGAGGGTGG + Intronic
1198813336 X:140559234-140559256 GACTGGGAAGGGTGGGTAGGTGG - Intergenic
1198977307 X:142351288-142351310 GTGTGGGTTGGAAGGGAGGGTGG - Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1200071913 X:153533433-153533455 GTGTGGCTGGGGTGGGAGTGGGG + Intronic
1200246976 X:154531647-154531669 GTGGGGCCAGGGTGGGAGGGAGG - Exonic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201438541 Y:13985329-13985351 GTGTGGGGTGGGAGGGAGGGAGG - Intergenic
1201438609 Y:13985520-13985542 GTGTAGGGAGGGAGGGAGGGAGG - Intergenic
1201445964 Y:14057188-14057210 GTGTAGGGAGGGAGGGAGGGAGG + Intergenic
1201446032 Y:14057379-14057401 GTGTGGGGTGGGAGGGAGGGAGG + Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic
1201573836 Y:15440950-15440972 GTGTGGGTAGGGATGGCAAGGGG + Intergenic
1201578236 Y:15483587-15483609 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
1201671996 Y:16533360-16533382 GAGTTGAAAGGGTGGGAAGGTGG - Intergenic
1201855742 Y:18539525-18539547 GTGGGGGGAGGGGGGGAGGGGGG - Intergenic
1201877579 Y:18780860-18780882 GTGGGGGGAGGGGGGGAGGGGGG + Intronic
1202101235 Y:21310115-21310137 AGGTGGGTAGGGGGAGAAGGTGG + Intergenic
1202187112 Y:22197273-22197295 AGGTGGGTAGGGGGAGAAGGTGG + Intergenic
1202204248 Y:22389123-22389145 AGGTGGGTAGGGGGAGAAGGTGG - Intronic