ID: 1088323434

View in Genome Browser
Species Human (GRCh38)
Location 11:108577153-108577175
Sequence ATGTAGGTTGATCTGTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088323431_1088323434 3 Left 1088323431 11:108577127-108577149 CCTTATTCATTCATCCATTCATG 0: 1
1: 4
2: 65
3: 365
4: 1142
Right 1088323434 11:108577153-108577175 ATGTAGGTTGATCTGTATCCTGG 0: 1
1: 0
2: 0
3: 11
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088323434 Original CRISPR ATGTAGGTTGATCTGTATCC TGG Intronic
905124808 1:35708721-35708743 ATGTATGTGGCTCTGTGTCCCGG + Intergenic
905341963 1:37284431-37284453 AGGCAGGTTGATCAGTAACCAGG + Intergenic
907837486 1:58124497-58124519 ATTTAGGTAGATCAGTGTCCTGG - Intronic
912181668 1:107226471-107226493 ATGTAGGTTCATATGCCTCCAGG + Intronic
918656974 1:187039188-187039210 ATGCAGGGTGATTGGTATCCTGG + Intergenic
922685648 1:227636934-227636956 ATATATGTTGATCTGTTTTCTGG + Intronic
1063377113 10:5561119-5561141 ATGTAGTTGGATCTGAATGCTGG - Intergenic
1071048487 10:81415327-81415349 ATTTAGGTTGATCCGTATCTTGG + Intergenic
1071606540 10:86996889-86996911 ATGTGGGTTTATATGTATCTAGG - Intergenic
1073953713 10:108842175-108842197 ATGTAGTTTTTTCTGCATCCTGG + Intergenic
1074177058 10:111018364-111018386 ATGTTGGATCATCTGTTTCCAGG - Intergenic
1077966632 11:7140911-7140933 ATGTAGGTTGGTAAGTATACAGG + Intergenic
1083482849 11:62960787-62960809 GTGAAGGTTGAGCTGTGTCCTGG - Intronic
1085949048 11:81307396-81307418 ATTTAGGTTTTTCTGTATTCAGG - Intergenic
1087196597 11:95309960-95309982 TTGTAGGTTGATCTTTCTCACGG - Intergenic
1088323434 11:108577153-108577175 ATGTAGGTTGATCTGTATCCTGG + Intronic
1088939841 11:114442054-114442076 CCGTAGGTTGATATGTACCCTGG + Intronic
1089927447 11:122273306-122273328 ATGTTGTTTGATCTGAGTCCTGG - Intergenic
1093998922 12:25673757-25673779 ATGGAGGCTGATCTTTAGCCTGG + Intergenic
1094108692 12:26838831-26838853 ATGTAGGTAGTTCTGGATACAGG + Intergenic
1095192837 12:39277946-39277968 ATGTACGTGTATCTGTATCTGGG - Intergenic
1095889352 12:47221503-47221525 CCTTAGGTTGATCTGTATCCTGG - Intronic
1102127725 12:110498819-110498841 ATGAAGATTGTTCTATATCCAGG - Intronic
1109162794 13:58996873-58996895 ATTAAGGTTGATATGTATCTAGG - Intergenic
1110346634 13:74455722-74455744 ATGTAGGATGATCTGTGTCTAGG - Intergenic
1110536543 13:76657506-76657528 ATGTATGACCATCTGTATCCAGG + Intergenic
1111244123 13:85512534-85512556 ATGTCGGTTGATCTGCATCTGGG + Intergenic
1113260456 13:108556005-108556027 ACTTAGGTTGATCTATATTCTGG + Intergenic
1113664142 13:112129220-112129242 ATTTAGGTTGATCTGTATGTTGG - Intergenic
1118756119 14:68844979-68845001 ACTTATGTTGATCTGTATCTTGG + Intergenic
1120759080 14:88270186-88270208 ATGCAGGCTGAGCTGTAACCTGG - Intronic
1122637526 14:103137381-103137403 ATGTATGTTGAACAGGATCCAGG + Exonic
1128809469 15:70560230-70560252 AGGTAAGTTGATCTGTATGAAGG + Intergenic
1135611372 16:23870671-23870693 ACGTAGGTTGATCAGGACCCTGG + Intronic
1138753280 16:59450425-59450447 ATTTTGGTTGATTTGAATCCAGG + Intergenic
1138995068 16:62440771-62440793 ATCTAGGTTAATCCGTATCTTGG - Intergenic
1139945537 16:70638954-70638976 ATGTAGGTAGATCTGGTTCAGGG + Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1148702365 17:49596626-49596648 ATGTAGGATGATCAGTATTTGGG - Intergenic
1149675393 17:58456062-58456084 ATTTAGGTTGATCCATATCTTGG - Intronic
1151952722 17:77364081-77364103 ATTTAGGTTGATCTGGCTGCCGG + Intronic
1153152020 18:2106423-2106445 AGGAAGGTTGACCTGTATCAGGG - Intergenic
1154108499 18:11546121-11546143 ATATAGATTGATCTGGTTCCAGG + Intergenic
1156246961 18:35309920-35309942 ATCTATGTTGATCTGATTCCAGG + Intergenic
1157524023 18:48365052-48365074 ATGTAGCATGATCTATATCAGGG - Intronic
1161429237 19:4221768-4221790 ATGATGGTTTATCTGTAGCCTGG + Intronic
927255604 2:21038041-21038063 AAGTAGGTTCATCTTTCTCCGGG + Exonic
929725445 2:44421995-44422017 ATGCAGGTTGATCTGTGTAGAGG - Intronic
932532965 2:72557402-72557424 ATGTAGATTGAATTGTATCAAGG - Intronic
933007777 2:77017137-77017159 ATCTATGTTGATGTTTATCCTGG - Intronic
933233306 2:79834978-79835000 ATGTAAGTTGAGCTGTTTGCAGG + Intronic
943052121 2:182926854-182926876 TTGTAGTTTTATCTGTCTCCTGG + Exonic
944825698 2:203481159-203481181 ATGTAGTTAGTTCTGTATCTAGG + Intronic
947848711 2:233266709-233266731 ATGTAGATTGATCCGTATCTTGG - Intronic
1169657235 20:7938727-7938749 ATGGAGGCTGATATGCATCCAGG + Intronic
1169855559 20:10098548-10098570 ACTTAGGTTGATCTGTATCTTGG - Intergenic
1170674871 20:18469667-18469689 AGGTAGTTTGAGCTGTTTCCTGG - Intronic
1173841537 20:46160604-46160626 ATCCAGGTTGATCTGTCTGCAGG - Intergenic
1175147675 20:56909230-56909252 AAGAAGCTTGATCTCTATCCTGG + Intergenic
1178333682 21:31724671-31724693 TTGTAGGTTGTTCTGTGTCATGG - Intronic
1182793271 22:32971186-32971208 ATGTAGGTTTATCAGCTTCCTGG - Intronic
1183971556 22:41481401-41481423 CTGTAGCTTGCTCTGTATGCTGG + Intronic
949214882 3:1554282-1554304 ATGTAGAATGATCTGAATACTGG + Intergenic
950270105 3:11607276-11607298 TTGTAGGTTCATCTGTGTCATGG - Intronic
958490915 3:94771721-94771743 ATTTATGTTGATCTATATCTTGG - Intergenic
963728046 3:148943789-148943811 ATGGAGGTTGGTCTGGATTCTGG - Intergenic
963825766 3:149951503-149951525 CTATAGGTTGATTTGTATCATGG + Intronic
966083448 3:176035873-176035895 ACTTAGGTTGATCTGTATCTTGG + Intergenic
970784602 4:19780940-19780962 ATGGAGGTTGATCTTTCTCCTGG - Intergenic
971522887 4:27577370-27577392 ATGTTGGTTGTTGTGTGTCCTGG + Intergenic
977683688 4:99823610-99823632 ATTTAGGTTGATCTAGATTCTGG + Intronic
988617173 5:32785908-32785930 ATGTAATTTGATCTTTATCAAGG + Intronic
989093174 5:37755710-37755732 CTGAAGGTTGGTCTGCATCCAGG + Intergenic
990331173 5:54726921-54726943 CTGAAGGTATATCTGTATCCCGG - Intergenic
993639547 5:90385189-90385211 ATGTAGGTTGGTGTTTATTCAGG + Intergenic
994695698 5:103070934-103070956 ATTTAGGTTGATCCATATCATGG + Intergenic
998071919 5:139204513-139204535 ATGTGGGATGGGCTGTATCCTGG + Intronic
1017339286 6:153302005-153302027 ACGGAGGTTTTTCTGTATCCCGG + Intergenic
1021423196 7:20468684-20468706 ATGGAGTTTGATCTGTTGCCAGG + Intergenic
1027820727 7:83040614-83040636 ATGTAGGCTGAACTGTATGTAGG - Intronic
1032644051 7:133801642-133801664 ATGTGGGTTTCTCTGTAACCTGG - Intronic
1052012430 9:23426342-23426364 ATGTAGGTGGACCTGGAGCCAGG + Intergenic
1053544466 9:39009074-39009096 ATGAAGGTGGGTCTGTAGCCTGG - Intergenic
1053808900 9:41832556-41832578 ATGAAGGTGGATCTGTAGCCTGG - Intergenic
1054621692 9:67354872-67354894 ATGAAGGTGGATCTGTAGCCTGG + Intergenic
1056083407 9:83120865-83120887 ATGGTGGTTGATATGTATCAAGG - Intergenic
1195206019 X:102600914-102600936 CTGTAGGTAGATCTGTCCCCAGG + Exonic
1197470661 X:126863581-126863603 TTGTAGGTGGATCTTTTTCCTGG - Intergenic