ID: 1088324943

View in Genome Browser
Species Human (GRCh38)
Location 11:108592342-108592364
Sequence TCCAGGGACCCTCTTCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 136}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088324943_1088324955 26 Left 1088324943 11:108592342-108592364 CCAATTTGAAGAGGGTCCCTGGA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1088324955 11:108592391-108592413 CAGGCAATTCTAGAAAGAATTGG 0: 1
1: 0
2: 2
3: 23
4: 206
1088324943_1088324952 1 Left 1088324943 11:108592342-108592364 CCAATTTGAAGAGGGTCCCTGGA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1088324952 11:108592366-108592388 GGTTTCTTTTGTCGGCGGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 155
1088324943_1088324951 0 Left 1088324943 11:108592342-108592364 CCAATTTGAAGAGGGTCCCTGGA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1088324951 11:108592365-108592387 GGGTTTCTTTTGTCGGCGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 76
1088324943_1088324947 -7 Left 1088324943 11:108592342-108592364 CCAATTTGAAGAGGGTCCCTGGA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1088324947 11:108592358-108592380 CCCTGGAGGGTTTCTTTTGTCGG 0: 1
1: 0
2: 2
3: 14
4: 175
1088324943_1088324950 -1 Left 1088324943 11:108592342-108592364 CCAATTTGAAGAGGGTCCCTGGA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1088324950 11:108592364-108592386 AGGGTTTCTTTTGTCGGCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 89
1088324943_1088324953 2 Left 1088324943 11:108592342-108592364 CCAATTTGAAGAGGGTCCCTGGA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1088324953 11:108592367-108592389 GTTTCTTTTGTCGGCGGTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 284
1088324943_1088324954 7 Left 1088324943 11:108592342-108592364 CCAATTTGAAGAGGGTCCCTGGA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1088324954 11:108592372-108592394 TTTTGTCGGCGGTGGGGGACAGG 0: 1
1: 0
2: 1
3: 30
4: 239
1088324943_1088324949 -4 Left 1088324943 11:108592342-108592364 CCAATTTGAAGAGGGTCCCTGGA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1088324949 11:108592361-108592383 TGGAGGGTTTCTTTTGTCGGCGG 0: 1
1: 0
2: 0
3: 16
4: 132
1088324943_1088324956 27 Left 1088324943 11:108592342-108592364 CCAATTTGAAGAGGGTCCCTGGA 0: 1
1: 0
2: 1
3: 13
4: 136
Right 1088324956 11:108592392-108592414 AGGCAATTCTAGAAAGAATTGGG 0: 1
1: 0
2: 3
3: 28
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088324943 Original CRISPR TCCAGGGACCCTCTTCAAAT TGG (reversed) Intronic
900582015 1:3414115-3414137 TCCAGGGACCCCCTTCAGAGTGG + Intronic
902942832 1:19813055-19813077 CCCAGTGACCCTCTTCAGCTTGG + Intergenic
905416913 1:37810004-37810026 TCCAGCCACCCTCCCCAAATAGG + Exonic
907147319 1:52247061-52247083 TCAAGGGATCCTCTTCACCTCGG + Intronic
907372193 1:54010763-54010785 TCCAGGAAGCCTCTTCCAACTGG + Intronic
909034420 1:70581052-70581074 TACACGGACCCTCTTTAAACAGG + Intergenic
917076768 1:171214135-171214157 TCCAGGGACCTTCTCCCACTTGG + Intergenic
920254227 1:204643535-204643557 TCCTCGCCCCCTCTTCAAATGGG - Intronic
921843902 1:219858927-219858949 AACTTGGACCCTCTTCAAATAGG + Intronic
1063512318 10:6657499-6657521 TCCAGGGACCTTCTGCTAAGTGG + Intergenic
1066209605 10:33223984-33224006 TCCAGCAACCCTCTTCATGTTGG - Intronic
1071729608 10:88234417-88234439 TCCAAGGAGCCTTTTCAAAAGGG + Intergenic
1077020726 11:416114-416136 TCCAAGGACCCACTTCAAGGAGG - Intronic
1077634704 11:3834622-3834644 TCCAGGGACCACATTCAGATAGG - Intronic
1078195412 11:9133077-9133099 ACCAGGGACCCACTTCACAATGG + Intronic
1078319310 11:10319489-10319511 TACTGGAACCCTCTGCAAATAGG - Intronic
1078609547 11:12808524-12808546 CTCAGAGACCCTCTGCAAATTGG - Intronic
1079379618 11:19926385-19926407 TCCAGGGATCCTCTCCAAGATGG + Intronic
1079424552 11:20327711-20327733 TAGAGCGACCGTCTTCAAATTGG - Intergenic
1081851548 11:46278079-46278101 TCCCGGGACCCCCTTCCACTGGG - Exonic
1083141969 11:60729581-60729603 TCCAGGCACCGTCTGCAAACTGG - Exonic
1084236456 11:67790940-67790962 TTAAGGCTCCCTCTTCAAATCGG + Intergenic
1084692127 11:70733736-70733758 TCCCGGGTCCCTCTTCTAGTGGG - Intronic
1084715549 11:70871227-70871249 TGCAGGGACACACTTCAAAGGGG + Intronic
1088324943 11:108592342-108592364 TCCAGGGACCCTCTTCAAATTGG - Intronic
1089012612 11:115143241-115143263 TCCAGGGACACTGTTCACATAGG + Intergenic
1089842890 11:121434116-121434138 TGCAGGGAGCTTGTTCAAATTGG + Intergenic
1091173260 11:133537240-133537262 CCCAGGGACTCTCTTACAATGGG + Intergenic
1095166661 12:38981429-38981451 TCCTTGGACACTCTGCAAATAGG + Intergenic
1096258102 12:50074961-50074983 GCCAGGGACCCTCTTCCTAGGGG + Intronic
1097850011 12:64402425-64402447 CTCAGGGACCATCTCCAAATAGG - Intergenic
1098730896 12:74036136-74036158 TCCAGGGACCCACTGTAAGTTGG - Intergenic
1102399808 12:112618545-112618567 CCCAGGGTTCCTCTTGAAATGGG - Intronic
1102924782 12:116818580-116818602 TCACTGGACCCTCTTCAACTGGG + Intronic
1105234915 13:18541641-18541663 GCCAGAGTCCCTCTTCAAATAGG - Intergenic
1107119686 13:36782596-36782618 TCCAGAGACCCTCTCTAAATGGG + Intergenic
1116756005 14:48948909-48948931 TCAAGGAAGCCTCTTCAAAGAGG - Intergenic
1116970981 14:51065837-51065859 TCAAAGCACCCTCTTCAAGTGGG - Intronic
1122780752 14:104142453-104142475 TCCAGGGACCTTTCTCTAATGGG + Intronic
1125254742 15:37750570-37750592 TCCATGGCCCATTTTCAAATTGG - Intergenic
1125796667 15:42408807-42408829 TCCAGGGCCCCTCTTCTATCCGG + Intronic
1128813700 15:70589797-70589819 TCCAAGGCACCTCTTAAAATAGG - Intergenic
1129549883 15:76436966-76436988 TCCAGTGAACCTCTGAAAATGGG - Intronic
1130956291 15:88629549-88629571 TCCAGGGACCTTGCTTAAATGGG + Intronic
1138094823 16:54203301-54203323 TCTAAGGACCCTCTTAGAATGGG + Intergenic
1139175060 16:64677228-64677250 CACTGGGAGCCTCTTCAAATTGG - Intergenic
1141356155 16:83348729-83348751 TTCTAGGACCCTCTGCAAATGGG + Intronic
1146585763 17:34080253-34080275 TCCAGGGAGCACCTTCATATAGG + Intronic
1148724609 17:49779639-49779661 TCCAGGGACCTTCTCCAGATTGG - Intronic
1150272678 17:63876713-63876735 GGCAGGGACCCTCTTCTACTTGG - Intronic
1150276171 17:63899261-63899283 GGCAGGGACCCTCTTCTACTTGG - Intergenic
1151160876 17:72164654-72164676 ATCAGGGACCCTCTTTAAATGGG - Intergenic
1151869248 17:76825441-76825463 TCCAGGGGCTCTCTACAAGTGGG + Intergenic
1152479263 17:80538976-80538998 CCCAGGGACCCTTTTAAAAATGG + Intergenic
1154514622 18:15148232-15148254 GCCAGAGTCCCTCTTCAAATAGG + Intergenic
1156699013 18:39800405-39800427 TCCAGGGACCCTCTGTCACTTGG + Intergenic
1160117615 18:76096601-76096623 TCCAGGGAGCTTCTCCAAGTTGG - Intergenic
1161715922 19:5876400-5876422 TCCAGGGAGCCTCCCCAGATAGG + Intronic
1162386894 19:10365289-10365311 TCCAGGGAACCCCTTCATCTGGG - Intronic
1165318799 19:35073817-35073839 TGCAGGGAGCCTCTTCCCATGGG - Intergenic
925726492 2:6877743-6877765 GCCAGGGACTCTCTTTATATAGG - Exonic
927343672 2:22011118-22011140 CCCTGGGTCCCTTTTCAAATGGG + Intergenic
927994157 2:27471018-27471040 TCCTGGGACCCACTGCATATAGG + Exonic
930565882 2:53020068-53020090 TCCTGAGACCCTCCTCAAACAGG + Intergenic
931803510 2:65781326-65781348 ACCAGGCACCCTCTTCCAACAGG - Intergenic
936091972 2:109507282-109507304 ACCAGGGACCGTCTTGGAATCGG + Intergenic
937969068 2:127535879-127535901 CCCAGCGACCCTCTTCAGAGAGG - Intronic
938094147 2:128450734-128450756 TCCAGGGAGCCATTTCTAATGGG + Intergenic
938514874 2:131992994-131993016 GCCAGAGTCCCTCTTCAAATAGG + Intergenic
939623394 2:144447751-144447773 TTCAGGGCCCAACTTCAAATAGG + Intronic
948516971 2:238510161-238510183 TCCAGGGACCCCTTTCTAGTAGG - Intergenic
1169166904 20:3431901-3431923 TCCAGACACCCTCTGAAAATGGG - Intergenic
1170715352 20:18826430-18826452 TCCAGGGAAGCTCTTGAAAGAGG + Intronic
1170756534 20:19211472-19211494 GCCAGGGATCCCCTCCAAATGGG + Intergenic
1172895359 20:38296136-38296158 TCCAGGCACCCTCCTGAAACTGG - Intronic
1175922696 20:62457481-62457503 CCCGGGGACCCTCTTCACACAGG + Intergenic
1177976555 21:27859071-27859093 GCCAGAGTCCCTCTTCAAATAGG - Intergenic
1182961562 22:34480178-34480200 TCCAGGGCCTGGCTTCAAATAGG - Intergenic
950887687 3:16375300-16375322 TCCAGGGACCCTGTCCTTATTGG - Intronic
951755942 3:26091351-26091373 TCCAGGGCCCTGCTTCAAGTGGG + Intergenic
952599296 3:35059879-35059901 TCCAGTGATCCTTTGCAAATGGG + Intergenic
954329625 3:49882734-49882756 TCCAGTCACCCTGTTCACATGGG - Intergenic
955093243 3:55772733-55772755 CCAAGGGACCCTCTTCATCTTGG - Intronic
957408038 3:79797330-79797352 TCCAGGTACGTTTTTCAAATAGG + Intergenic
960488227 3:118279017-118279039 TCCCGGGACTTTCTTTAAATGGG - Intergenic
966523098 3:180894478-180894500 TCCAGGGACCCTCTTCCACCTGG - Intronic
967630321 3:191737682-191737704 TCCAGGGACCCCCTCCAACCTGG + Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
971804786 4:31341842-31341864 TCCAGGGAGACTTTTCACATTGG - Intergenic
972679395 4:41290746-41290768 TCCAGGGACCCTTTTATATTTGG + Intergenic
973110225 4:46389632-46389654 TCCAGGGAGCCTCTGAAAGTGGG + Intronic
974318323 4:60311172-60311194 TGCAGAGAATCTCTTCAAATGGG - Intergenic
976688789 4:87845902-87845924 TCCAGGGAGCTCCTTAAAATTGG - Exonic
978939932 4:114423996-114424018 TTCAGGGTCCCTCAGCAAATGGG - Intergenic
980726602 4:136769828-136769850 TCCAGGGACCCCCTTCCACCTGG - Intergenic
982094507 4:151909697-151909719 TCCAGGCAGCCTATTCAAACTGG + Intergenic
984681690 4:182618242-182618264 TCCAGGGATGCTTTTCAATTGGG + Intronic
985838233 5:2286150-2286172 TCCACGGAGCCTATTCAGATTGG + Intergenic
986702310 5:10422675-10422697 TCTAAGGATCTTCTTCAAATGGG - Intronic
987136985 5:14909416-14909438 TCCAAAAACACTCTTCAAATTGG + Intergenic
991656754 5:68911976-68911998 CCTGGGGTCCCTCTTCAAATGGG + Intergenic
992137661 5:73763565-73763587 TCCAGGGACCCTGTTCTGTTTGG - Intronic
997248442 5:132370607-132370629 TCCTGGTACCCTCTTCAAAGTGG - Intronic
997430340 5:133834192-133834214 TCCAGAGACCCTGTGCTAATGGG + Intergenic
997719624 5:136067084-136067106 TCCAGGGAGCCTCCTCTAACAGG - Intergenic
998162513 5:139821640-139821662 TCCAGGGACCTTCTGAAATTAGG - Intronic
1001598115 5:172911254-172911276 GCCAGGGAACCTGTTGAAATAGG + Intronic
1001599991 5:172922560-172922582 TCCTGGGACCCTCTTCCACATGG - Intronic
1005185010 6:23155859-23155881 TCCAGGGACCCACTGTAAGTCGG - Intergenic
1005622624 6:27634210-27634232 TCCAGGGACCCACTGTAAGTCGG + Intergenic
1006933296 6:37700054-37700076 TCCAGGAACCCTCTAATAATGGG - Intergenic
1006966485 6:37991104-37991126 TCCAGAGACCCTCCTCCAGTGGG - Intronic
1009908383 6:69895692-69895714 TCCAGGGACCCCCTCCCACTTGG + Intronic
1011217852 6:85024413-85024435 TCCCGCGACCCTCTGCAAAGTGG + Intergenic
1011284743 6:85711025-85711047 CCAAGGGAGCCTCTTCAAGTTGG + Intergenic
1016220036 6:141656400-141656422 TCCAGGGACCCACTGTAAGTCGG - Intergenic
1016918443 6:149266648-149266670 TCCAGGCACCCTGACCAAATTGG + Intronic
1018465065 6:164036487-164036509 TCCAGGGACCCCATTAAAAGAGG - Intergenic
1020223358 7:6259370-6259392 ACCAGGAACACTGTTCAAATAGG - Intronic
1022547899 7:31206008-31206030 TATAGGGAACCTCTTCAAAATGG - Intergenic
1023059547 7:36314733-36314755 TCCAGGGACCCACTCCCAAAGGG - Intergenic
1023393585 7:39732758-39732780 TCCGGGGACCCTCCTCAAGCTGG + Intergenic
1028756509 7:94440991-94441013 TCCAGGGACCCTCTCCCACCTGG + Intergenic
1029275056 7:99399040-99399062 TCCAGGAACCCAGTGCAAATAGG - Intronic
1032109769 7:129066027-129066049 TACAGGGACCCTTCTGAAATGGG - Intergenic
1032982963 7:137306181-137306203 TCCAGTTGCCCTCTTTAAATGGG + Intronic
1035579098 8:728652-728674 TCCTGGGACCCTCTTCAATTAGG + Intronic
1037888314 8:22606863-22606885 GCCAGGGTCCCTCTTCTGATGGG + Intronic
1039888247 8:41667714-41667736 CCCAGGGCCCCTCTTCTACTTGG + Intronic
1043034944 8:75184951-75184973 TCCAGGGACATTTTTCAAATAGG - Intergenic
1043305436 8:78787736-78787758 TCCACGGCCTCTCTTCAAAGTGG + Intronic
1045575922 8:103419693-103419715 TCCTAGTACCCTCTTCAACTGGG - Intronic
1051031059 9:12679214-12679236 TCAAGGGACCTTCTGTAAATGGG + Intergenic
1051908434 9:22124367-22124389 TCCAGTGACACTCCACAAATTGG - Intergenic
1052571006 9:30223538-30223560 TCAAAGAACCCTCTTCAAAATGG - Intergenic
1056451545 9:86721746-86721768 GCCAGGGACCCTCTCCAGAGCGG - Intergenic
1058146207 9:101414532-101414554 TTCAGGGACCTTCTTCAACTTGG + Intergenic
1059395395 9:114031279-114031301 CCCAGGGAGCATCTACAAATTGG - Intronic
1062427331 9:136512009-136512031 TCCAGGGCCTCTCTTCCTATTGG + Intronic
1189035483 X:37490572-37490594 TCCAGGCTCCTTCTCCAAATTGG + Intronic
1189152871 X:38725944-38725966 TCCAGGGACCCCCTTCCACCTGG - Intergenic
1189455949 X:41190382-41190404 CCCAAGGACCTTCTTAAAATAGG - Intronic
1190491206 X:50983989-50984011 TCCAGGGACCCCCTCCCACTTGG - Intergenic
1193996720 X:88374814-88374836 CCCAGGGAGCCTCTTCCTATTGG - Intergenic
1194403185 X:93462460-93462482 TCCAGGGACCCCCTCCTAACTGG + Intergenic
1195245601 X:102992510-102992532 TCCAGGGACCCCCTCCCATTTGG - Intergenic
1196001476 X:110791552-110791574 TCCAGGGACCGTTAGCAAATTGG - Intronic
1197591711 X:128418172-128418194 TCCAGGGACCCACTGTAAGTTGG - Intergenic
1198110497 X:133498623-133498645 TCCAGGGACTCTGTTTTAATTGG + Intergenic
1198369991 X:135981064-135981086 TACAGGGCCCCTCTTCAGAAAGG - Intergenic
1199270525 X:145877658-145877680 TCCAGGGCCCCTCTTCGATGAGG - Intergenic