ID: 1088326799

View in Genome Browser
Species Human (GRCh38)
Location 11:108609129-108609151
Sequence CTCTTCACACCCACCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088326794_1088326799 10 Left 1088326794 11:108609096-108609118 CCTATGTATGTGATTCTTAAGCA No data
Right 1088326799 11:108609129-108609151 CTCTTCACACCCACCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088326799 Original CRISPR CTCTTCACACCCACCCCAGT GGG Intergenic
No off target data available for this crispr