ID: 1088327657

View in Genome Browser
Species Human (GRCh38)
Location 11:108617283-108617305
Sequence GAGAGGATAAGGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088327646_1088327657 20 Left 1088327646 11:108617240-108617262 CCAGGGCCTGTAGTCTCAGCTAA No data
Right 1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG No data
1088327648_1088327657 14 Left 1088327648 11:108617246-108617268 CCTGTAGTCTCAGCTAATGGTGT No data
Right 1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088327657 Original CRISPR GAGAGGATAAGGAGGGAGGA TGG Intergenic
No off target data available for this crispr