ID: 1088330178

View in Genome Browser
Species Human (GRCh38)
Location 11:108643151-108643173
Sequence TTGTATTTTCAGAAGAGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088330178_1088330181 10 Left 1088330178 11:108643151-108643173 CCTCGCCTCTTCTGAAAATACAA No data
Right 1088330181 11:108643184-108643206 GGTGTAGTGATGCACGCCTGTGG No data
1088330178_1088330182 24 Left 1088330178 11:108643151-108643173 CCTCGCCTCTTCTGAAAATACAA No data
Right 1088330182 11:108643198-108643220 CGCCTGTGGTCCCAGCTACTTGG 0: 1698
1: 50471
2: 116116
3: 175602
4: 127583
1088330178_1088330183 25 Left 1088330178 11:108643151-108643173 CCTCGCCTCTTCTGAAAATACAA No data
Right 1088330183 11:108643199-108643221 GCCTGTGGTCCCAGCTACTTGGG 0: 2717
1: 41335
2: 169840
3: 257462
4: 215499
1088330178_1088330185 28 Left 1088330178 11:108643151-108643173 CCTCGCCTCTTCTGAAAATACAA No data
Right 1088330185 11:108643202-108643224 TGTGGTCCCAGCTACTTGGGAGG 0: 4395
1: 51934
2: 165955
3: 225063
4: 222996

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088330178 Original CRISPR TTGTATTTTCAGAAGAGGCG AGG (reversed) Intergenic
No off target data available for this crispr