ID: 1088330181

View in Genome Browser
Species Human (GRCh38)
Location 11:108643184-108643206
Sequence GGTGTAGTGATGCACGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088330178_1088330181 10 Left 1088330178 11:108643151-108643173 CCTCGCCTCTTCTGAAAATACAA No data
Right 1088330181 11:108643184-108643206 GGTGTAGTGATGCACGCCTGTGG No data
1088330179_1088330181 5 Left 1088330179 11:108643156-108643178 CCTCTTCTGAAAATACAAAAATT No data
Right 1088330181 11:108643184-108643206 GGTGTAGTGATGCACGCCTGTGG No data
1088330177_1088330181 28 Left 1088330177 11:108643133-108643155 CCAGGATAACACGGCAAACCTCG No data
Right 1088330181 11:108643184-108643206 GGTGTAGTGATGCACGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088330181 Original CRISPR GGTGTAGTGATGCACGCCTG TGG Intergenic
No off target data available for this crispr