ID: 1088330182

View in Genome Browser
Species Human (GRCh38)
Location 11:108643198-108643220
Sequence CGCCTGTGGTCCCAGCTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471470
Summary {0: 1698, 1: 50471, 2: 116116, 3: 175602, 4: 127583}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088330179_1088330182 19 Left 1088330179 11:108643156-108643178 CCTCTTCTGAAAATACAAAAATT No data
Right 1088330182 11:108643198-108643220 CGCCTGTGGTCCCAGCTACTTGG 0: 1698
1: 50471
2: 116116
3: 175602
4: 127583
1088330178_1088330182 24 Left 1088330178 11:108643151-108643173 CCTCGCCTCTTCTGAAAATACAA No data
Right 1088330182 11:108643198-108643220 CGCCTGTGGTCCCAGCTACTTGG 0: 1698
1: 50471
2: 116116
3: 175602
4: 127583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088330182 Original CRISPR CGCCTGTGGTCCCAGCTACT TGG Intergenic
Too many off-targets to display for this crispr