ID: 1088330183

View in Genome Browser
Species Human (GRCh38)
Location 11:108643199-108643221
Sequence GCCTGTGGTCCCAGCTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 686853
Summary {0: 2717, 1: 41335, 2: 169840, 3: 257462, 4: 215499}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088330179_1088330183 20 Left 1088330179 11:108643156-108643178 CCTCTTCTGAAAATACAAAAATT No data
Right 1088330183 11:108643199-108643221 GCCTGTGGTCCCAGCTACTTGGG 0: 2717
1: 41335
2: 169840
3: 257462
4: 215499
1088330178_1088330183 25 Left 1088330178 11:108643151-108643173 CCTCGCCTCTTCTGAAAATACAA No data
Right 1088330183 11:108643199-108643221 GCCTGTGGTCCCAGCTACTTGGG 0: 2717
1: 41335
2: 169840
3: 257462
4: 215499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088330183 Original CRISPR GCCTGTGGTCCCAGCTACTT GGG Intergenic
Too many off-targets to display for this crispr