ID: 1088330185

View in Genome Browser
Species Human (GRCh38)
Location 11:108643202-108643224
Sequence TGTGGTCCCAGCTACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670343
Summary {0: 4395, 1: 51934, 2: 165955, 3: 225063, 4: 222996}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088330179_1088330185 23 Left 1088330179 11:108643156-108643178 CCTCTTCTGAAAATACAAAAATT No data
Right 1088330185 11:108643202-108643224 TGTGGTCCCAGCTACTTGGGAGG 0: 4395
1: 51934
2: 165955
3: 225063
4: 222996
1088330178_1088330185 28 Left 1088330178 11:108643151-108643173 CCTCGCCTCTTCTGAAAATACAA No data
Right 1088330185 11:108643202-108643224 TGTGGTCCCAGCTACTTGGGAGG 0: 4395
1: 51934
2: 165955
3: 225063
4: 222996

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088330185 Original CRISPR TGTGGTCCCAGCTACTTGGG AGG Intergenic
Too many off-targets to display for this crispr