ID: 1088330630

View in Genome Browser
Species Human (GRCh38)
Location 11:108647540-108647562
Sequence GCTCAGTGTAGTACTGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088330630_1088330633 4 Left 1088330630 11:108647540-108647562 CCCTTGGCAGTACTACACTGAGC No data
Right 1088330633 11:108647567-108647589 AGAGAGAACATGTGCTCTTGTGG No data
1088330630_1088330634 5 Left 1088330630 11:108647540-108647562 CCCTTGGCAGTACTACACTGAGC No data
Right 1088330634 11:108647568-108647590 GAGAGAACATGTGCTCTTGTGGG No data
1088330630_1088330638 28 Left 1088330630 11:108647540-108647562 CCCTTGGCAGTACTACACTGAGC No data
Right 1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG No data
1088330630_1088330637 27 Left 1088330630 11:108647540-108647562 CCCTTGGCAGTACTACACTGAGC No data
Right 1088330637 11:108647590-108647612 GAGGGAGAGCAAAGTGAGTGTGG No data
1088330630_1088330636 9 Left 1088330630 11:108647540-108647562 CCCTTGGCAGTACTACACTGAGC No data
Right 1088330636 11:108647572-108647594 GAACATGTGCTCTTGTGGGAGGG No data
1088330630_1088330635 8 Left 1088330630 11:108647540-108647562 CCCTTGGCAGTACTACACTGAGC No data
Right 1088330635 11:108647571-108647593 AGAACATGTGCTCTTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088330630 Original CRISPR GCTCAGTGTAGTACTGCCAA GGG (reversed) Intergenic
No off target data available for this crispr