ID: 1088330638

View in Genome Browser
Species Human (GRCh38)
Location 11:108647591-108647613
Sequence AGGGAGAGCAAAGTGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088330631_1088330638 27 Left 1088330631 11:108647541-108647563 CCTTGGCAGTACTACACTGAGCG No data
Right 1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG No data
1088330630_1088330638 28 Left 1088330630 11:108647540-108647562 CCCTTGGCAGTACTACACTGAGC No data
Right 1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088330638 Original CRISPR AGGGAGAGCAAAGTGAGTGT GGG Intergenic
No off target data available for this crispr