ID: 1088330918

View in Genome Browser
Species Human (GRCh38)
Location 11:108650541-108650563
Sequence AAAAAAAAGGAGCAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088330911_1088330918 17 Left 1088330911 11:108650501-108650523 CCTGGGTAACAGAGTGAGACCCT 0: 488
1: 12901
2: 51433
3: 126304
4: 227353
Right 1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG No data
1088330914_1088330918 -10 Left 1088330914 11:108650528-108650550 CCAATTAAAAAAAAAAAAAAAGG 0: 7
1: 90
2: 1300
3: 10157
4: 62968
Right 1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG No data
1088330910_1088330918 21 Left 1088330910 11:108650497-108650519 CCAGCCTGGGTAACAGAGTGAGA 0: 1649
1: 57128
2: 142111
3: 219577
4: 236031
Right 1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG No data
1088330913_1088330918 -3 Left 1088330913 11:108650521-108650543 CCTGTTTCCAATTAAAAAAAAAA No data
Right 1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG No data
1088330912_1088330918 -2 Left 1088330912 11:108650520-108650542 CCCTGTTTCCAATTAAAAAAAAA No data
Right 1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088330918 Original CRISPR AAAAAAAAGGAGCAGGAGGC AGG Intergenic
No off target data available for this crispr