ID: 1088334162

View in Genome Browser
Species Human (GRCh38)
Location 11:108685177-108685199
Sequence CAGCGCGATTCCGTGGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088334157_1088334162 16 Left 1088334157 11:108685138-108685160 CCATGTTGTAGGTTGCCTGTTCA 0: 1124
1: 5173
2: 10533
3: 6586
4: 5444
Right 1088334162 11:108685177-108685199 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1088334156_1088334162 17 Left 1088334156 11:108685137-108685159 CCCATGTTGTAGGTTGCCTGTTC 0: 1123
1: 5178
2: 10488
3: 6685
4: 5403
Right 1088334162 11:108685177-108685199 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1088334159_1088334162 1 Left 1088334159 11:108685153-108685175 CCTGTTCACTCTGATGGTAGCAA 0: 1
1: 4
2: 140
3: 12321
4: 7348
Right 1088334162 11:108685177-108685199 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088334162 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG Intronic
Too many off-targets to display for this crispr