ID: 1088334491

View in Genome Browser
Species Human (GRCh38)
Location 11:108688608-108688630
Sequence TTAGTATTCCACATCTCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088334491 Original CRISPR TTAGTATTCCACATCTCATT AGG (reversed) Intronic
900949636 1:5851151-5851173 TTTGTATTCCACATCTAATTAGG + Intergenic
907319478 1:53593722-53593744 TATGTTCTCCACATCTCATTTGG + Intronic
908867940 1:68573103-68573125 TTAGGATTCCACATATAATTGGG + Intergenic
910322406 1:85962307-85962329 TCAGTTTTCCACAACTCATTTGG + Intronic
910736578 1:90464975-90464997 TTTTTATTCTACATCTCAGTTGG + Intergenic
913494618 1:119417054-119417076 ATAGTATTACCCATCTCATAGGG - Intronic
914430532 1:147616869-147616891 TTAGTATCCCCCATAGCATTTGG - Intronic
917627065 1:176856972-176856994 TGAGTATTCCACACCTATTTTGG + Intergenic
919067198 1:192707556-192707578 TTAGTATTTCACATTTGAATTGG + Intergenic
921664744 1:217855128-217855150 TTGTTATTCCCCATTTCATTTGG + Intronic
923423164 1:233840902-233840924 TTAGTATCCCAGATTTCTTTTGG - Intergenic
1063307666 10:4920661-4920683 TAATTATTTCACATCTCATAAGG - Intergenic
1067981824 10:51095764-51095786 TTATTCTTACAAATCTCATTGGG - Intronic
1070098756 10:73365254-73365276 TTAGGATTCCACATATGAATAGG - Intergenic
1071956620 10:90767495-90767517 TTAGTCCACCACAGCTCATTGGG - Intronic
1072883044 10:99247725-99247747 TTAGAATTCCACATGAGATTTGG - Intergenic
1073666374 10:105538900-105538922 TTTGAATTCCACACATCATTGGG - Intergenic
1074383110 10:112996153-112996175 TTAGTATTCTAGAGCTCATCAGG + Intronic
1078499099 11:11851689-11851711 TTAGGATACCACATTGCATTTGG + Intronic
1078760636 11:14248600-14248622 TTCCTCTTCCAAATCTCATTAGG + Intronic
1078973529 11:16444088-16444110 TTCTTATTCCAAATCTCATTAGG - Intronic
1080134811 11:28842236-28842258 TTAGTAGTCCTTATCTCATAGGG + Intergenic
1081014293 11:37856790-37856812 TTAGTTTTCCACATTTTTTTAGG - Intergenic
1081015734 11:37877611-37877633 TGAATATTCCACATGTCTTTAGG - Intergenic
1081202089 11:40228988-40229010 TTAATATTTCACATCTTGTTCGG - Intronic
1081817166 11:45953759-45953781 TTAGTATTATAGATTTCATTGGG + Intronic
1086027453 11:82311689-82311711 TTAATGTTACCCATCTCATTGGG - Intergenic
1086891574 11:92264894-92264916 TTTGAAATCCACATCTCCTTGGG + Intergenic
1086947368 11:92856389-92856411 TGAGTATTTCACATGTAATTAGG - Intronic
1087477844 11:98660124-98660146 TTAGTTTTCCTTATTTCATTTGG - Intergenic
1087507567 11:99045152-99045174 TTAGTATGCCACATCTAAGAAGG + Intronic
1088128156 11:106453356-106453378 TTATTATTCCAGCTCTCTTTTGG + Intergenic
1088334491 11:108688608-108688630 TTAGTATTCCACATCTCATTAGG - Intronic
1088601491 11:111481686-111481708 ATAGTAATCCACATGTCAATAGG + Intronic
1092530348 12:9339051-9339073 TTTTTATTCCAAATGTCATTTGG + Intergenic
1093129022 12:15367679-15367701 GTAGTCTTCCCCATCTCAGTTGG + Intronic
1094759867 12:33520057-33520079 GTAATATTTCAAATCTCATTGGG + Intergenic
1098546522 12:71717687-71717709 TTAGTATGCCTTATCTTATTAGG - Intergenic
1099021073 12:77405511-77405533 TTAGGATTCAACATATAATTTGG + Intergenic
1103110208 12:118270574-118270596 TTTGTATTTCACTTCTCACTTGG + Intronic
1106771045 13:32960863-32960885 ATAGAATTTCACATCTTATTGGG - Intergenic
1108440886 13:50451627-50451649 TTAGAATTCCACATGAGATTTGG + Intronic
1112860360 13:103823373-103823395 TTAATATGCCACTTTTCATTTGG - Intergenic
1116610447 14:47063973-47063995 TTAGTATTTTAAATCTAATTTGG - Intronic
1118770547 14:68939991-68940013 TTAGTAATCCTCATCTCAGCAGG - Intronic
1120795846 14:88632104-88632126 AAAGTATTCCCCATCCCATTTGG + Intronic
1123492535 15:20793727-20793749 TTACAATTCCACATCAGATTGGG + Intergenic
1123549036 15:21362819-21362841 TTACAATTCCACATCAGATTGGG + Intergenic
1125113877 15:36065943-36065965 TTACTATTCCACTTTTCTTTTGG - Intergenic
1125267999 15:37906075-37906097 CTAAGATTCCACACCTCATTTGG + Intergenic
1125399904 15:39291083-39291105 TTTTTATTCCTCATCTCCTTGGG - Intergenic
1125969112 15:43897766-43897788 TTAAAATTCCACATCAGATTTGG - Intronic
1202957371 15_KI270727v1_random:90040-90062 TTACAATTCCACATCAGATTGGG + Intergenic
1133829019 16:9304789-9304811 ACAGTATTCCACATTTCCTTGGG + Intergenic
1134835581 16:17357952-17357974 TTAGTATTCCAGCTCTCAAGGGG - Intronic
1139673186 16:68505635-68505657 CCAGTATTCCACATTTGATTTGG + Intergenic
1144026872 17:11285243-11285265 TTAGGTTTGCACATCCCATTTGG + Intronic
1145928793 17:28668960-28668982 TTACTATACCGCATCTCTTTAGG + Intronic
1146734556 17:35227275-35227297 TTAGGATTCAACATATCTTTTGG - Intergenic
1149096167 17:52843479-52843501 TTAGTCTTCCAAATCAAATTAGG + Intergenic
1149244388 17:54688154-54688176 TTATAATTCCTCATCACATTAGG - Intergenic
1158519358 18:58158268-58158290 TTAGGCTTCCACCTCTCTTTTGG - Intronic
1168437040 19:56326545-56326567 TTAATATTCCACATATAAATGGG + Intronic
925550981 2:5074135-5074157 TTAGTATTCCCCATCTTCATAGG - Intergenic
931038051 2:58265314-58265336 TTTGTATTCCTGATCTCAGTGGG + Intergenic
932481755 2:72044518-72044540 TCAGTATTCTACATCTGACTGGG - Intergenic
932584139 2:73013249-73013271 TTTGTATTACACATCTCTTTTGG - Intronic
934155943 2:89200558-89200580 ATTGAATTCAACATCTCATTTGG + Intergenic
934677844 2:96262320-96262342 GGAGTATTCCACATCTCAAGAGG - Intronic
936544705 2:113381066-113381088 TTAGAATTCAACATGACATTTGG - Intergenic
936803083 2:116289920-116289942 TTAGGATTCCTCTTGTCATTTGG - Intergenic
937687816 2:124718164-124718186 TTTATGTCCCACATCTCATTTGG - Intronic
939969993 2:148647203-148647225 TTAGTATGCCACATATGTTTTGG + Intronic
940097467 2:149993816-149993838 TTAATGTTCCTCTTCTCATTTGG + Intergenic
940484584 2:154281410-154281432 TCATTACTCCACATCTTATTAGG - Intronic
940753664 2:157657288-157657310 TTAGAATTGCAAATCTCCTTGGG + Intergenic
941014739 2:160342606-160342628 TTATTTTTTCACATATCATTTGG - Intronic
941083973 2:161094816-161094838 GTAGTCTGTCACATCTCATTTGG + Intergenic
942989977 2:182188564-182188586 ATAGTAGTGCACATTTCATTTGG - Intronic
943211970 2:184978158-184978180 CTAGTCTTCCACATATCATCAGG - Intergenic
944279769 2:197882179-197882201 TTAATATTCCACACCAAATTAGG - Intronic
944396255 2:199270666-199270688 ATAGTACTCCAGATCTCTTTCGG - Exonic
948289029 2:236810809-236810831 TTATTACTCCACTTCTCACTTGG + Intergenic
1170189732 20:13633323-13633345 TTAGTTATCCAAATCTCCTTTGG - Intronic
1178081920 21:29074857-29074879 TTATAATTCCACATCATATTTGG - Intergenic
1178165262 21:29967303-29967325 CCAGTATTTCACATTTCATTTGG + Intergenic
1181091233 22:20473979-20474001 GTCATATTCCACATCTCACTTGG + Intronic
1182964611 22:34509494-34509516 TTGGTGTCCCACATCTCATTTGG + Intergenic
1184637344 22:45844046-45844068 TTTATATTCCTCTTCTCATTGGG + Exonic
951328949 3:21342320-21342342 TGTCTATTCAACATCTCATTTGG - Intergenic
951612555 3:24507604-24507626 TTTGTGTTCCGCATGTCATTAGG - Intergenic
951930402 3:27960137-27960159 TTAGTTTTCCCAAGCTCATTAGG - Intergenic
952102101 3:30026303-30026325 TTAGTATACAACATGTTATTTGG + Intergenic
952227192 3:31390573-31390595 TTAGTATTGCAAATATCACTGGG + Intergenic
953160941 3:40418264-40418286 TCAGTAATCCTCATCTCATCTGG - Intronic
953306416 3:41834385-41834407 TGAGTCTTCCAAATCACATTTGG - Intronic
953306460 3:41835035-41835057 TGAGTCTTCCAAATCACATTTGG - Intronic
955540077 3:59966181-59966203 TTAGTATTCAACCTCCCATTGGG + Intronic
956555916 3:70522154-70522176 TTAGTATTCCTTATAACATTTGG - Intergenic
957373804 3:79331270-79331292 ATAGTATTCAACATCAAATTGGG - Intronic
957398824 3:79681683-79681705 CCAGGATTCCACATCTCCTTGGG - Intronic
957757143 3:84504998-84505020 TTTTTATGCCACATCTCAGTTGG - Intergenic
958004993 3:87799198-87799220 CTAGGATTCATCATCTCATTTGG - Intergenic
958712053 3:97729197-97729219 TTAGTATACCTAATTTCATTTGG + Intronic
959489783 3:106975004-106975026 TGAATATTCTACATTTCATTAGG - Intergenic
961094321 3:124141563-124141585 TTATTTTTGTACATCTCATTTGG + Intronic
962679160 3:137781037-137781059 TTATTATTCTGCATGTCATTGGG - Intergenic
963267151 3:143250881-143250903 TTAGTATTTCACTTTTCAGTTGG - Intergenic
964775897 3:160276719-160276741 TTAGTACTACACATCTCTCTTGG + Intronic
965094716 3:164210121-164210143 TTAAACTTCCTCATCTCATTAGG - Intergenic
965337277 3:167442258-167442280 TTAATATTTAACATGTCATTTGG + Intronic
965845488 3:172956210-172956232 TTAGCTATCCAGATCTCATTTGG + Intronic
968854257 4:3107157-3107179 TGAGTTTTCCCCATCCCATTAGG + Intronic
969376357 4:6766044-6766066 TTAGCCTTTCACATCCCATTCGG + Intergenic
972388195 4:38587855-38587877 TTAGTATTCCATGTGTAATTTGG + Intergenic
972474380 4:39436450-39436472 TTACCATTCCACCTCTCCTTAGG + Intronic
973660791 4:53104812-53104834 TTAGTTCTCCACAGCTCATGGGG + Intronic
974070624 4:57120159-57120181 ATAGTATTACCCATCTCATGAGG + Intergenic
974613384 4:64246784-64246806 TTATTGTTTCAGATCTCATTGGG + Intergenic
974662264 4:64907435-64907457 TTAGGATTTCATACCTCATTTGG + Intergenic
976428266 4:84931214-84931236 TTAGTTATCCACATTTCAGTAGG + Intronic
977837025 4:101657183-101657205 GTCCTATTCCATATCTCATTTGG + Intronic
981714154 4:147736416-147736438 TTAGTCTTCCAAATCTCAGTGGG - Intronic
984177964 4:176442621-176442643 TAAGTAATCCACACCTCATGGGG + Intergenic
984199749 4:176703550-176703572 CTAGTATTCCACAGCACAGTAGG + Intronic
986702176 5:10421297-10421319 TTGATATTCCACATTTTATTTGG - Intronic
986819085 5:11445763-11445785 TGAGTATTCTACATCACATGTGG + Intronic
987007663 5:13726812-13726834 TTGCTACTCCACAGCTCATTTGG + Intronic
987151834 5:15048936-15048958 TTAGTTTTTGACACCTCATTAGG + Intergenic
989393708 5:40929884-40929906 TTAGTTTTCCACTTCTCATGGGG + Intronic
993143359 5:84062563-84062585 TGAGTATTCCTCCTCTAATTAGG + Intronic
995091330 5:108181186-108181208 TTATTATTTCACATCCAATTTGG - Intronic
995207306 5:109495491-109495513 TTAGGATTCTACATTGCATTTGG - Intergenic
998218858 5:140258834-140258856 CTAGTTTTTCACATCTCATTTGG - Intronic
998706120 5:144763123-144763145 TTAGAAATCAATATCTCATTAGG - Intergenic
999198230 5:149797598-149797620 TTATAATTCTACATTTCATTTGG + Intronic
999557505 5:152760950-152760972 TTAGTATACTAGTTCTCATTTGG + Intergenic
999905996 5:156141982-156142004 TTACAATTCCACATGACATTTGG - Intronic
1002808298 6:600373-600395 TTAGTATTTGAAATCTGATTAGG + Intronic
1007426814 6:41752046-41752068 CTAGGATTCCACATGGCATTTGG + Intronic
1010326900 6:74574815-74574837 TCAGTATTAAACATCACATTAGG + Intergenic
1011743690 6:90388397-90388419 TTAGTTTACCACATCAGATTTGG + Intergenic
1012731740 6:102891990-102892012 TATCTATTCCACAGCTCATTAGG - Intergenic
1012791802 6:103708449-103708471 TTATTATTCAACCTCTGATTGGG + Intergenic
1013831972 6:114283723-114283745 GAAGAATTGCACATCTCATTAGG - Intronic
1013869743 6:114742693-114742715 TTAGCCATCAACATCTCATTTGG - Intergenic
1017636189 6:156445242-156445264 TCAGTGTTTCACATCACATTTGG - Intergenic
1018672555 6:166191919-166191941 TTACTATGCCACATCGAATTGGG + Intergenic
1019956700 7:4420757-4420779 TTAGAATTCAACATCAGATTTGG - Intergenic
1020560450 7:9724910-9724932 TTAGTTTTCCACATCCATTTTGG - Intergenic
1020969621 7:14919270-14919292 GTTGTATTCCATATCTAATTTGG - Intronic
1020975462 7:15000602-15000624 TTAGTCTTCCCTATTTCATTCGG + Intergenic
1022340015 7:29459346-29459368 TTTGTTTTCCCCATGTCATTTGG + Intronic
1025140952 7:56463876-56463898 TTAGTTCTCCACCTCTCATTTGG + Intergenic
1025163578 7:56689378-56689400 TTAGTTCTCCACTTCTCATTTGG - Intergenic
1025706736 7:63873063-63873085 TTAGTTCTCCAGCTCTCATTTGG + Intergenic
1027831362 7:83182135-83182157 TTACAATTCCACATGTGATTGGG + Intergenic
1028289998 7:89054079-89054101 TTAGAATTCCACATGAAATTTGG - Intronic
1029583655 7:101455401-101455423 GTAGTATTACACCTCTCACTTGG + Intronic
1031344243 7:120645469-120645491 TTAGTATGGCACATGTCATGTGG - Intronic
1032326520 7:130934174-130934196 GTATTATTCCCTATCTCATTAGG + Intergenic
1033333983 7:140436776-140436798 TTATTTTTTCACATCTCACTAGG - Intergenic
1037553548 8:19998882-19998904 TTAGTTTTCCACCACTCATTTGG + Intergenic
1038615229 8:29087774-29087796 TGAGTCTCCCACATCTCATCTGG - Intronic
1040767518 8:50931750-50931772 TTAGAATTCCACATGAGATTTGG - Intergenic
1041644142 8:60234389-60234411 TTACTAATCCACATTTTATTTGG - Intronic
1041656776 8:60360149-60360171 TAAGTTTTCCACCTCTCATCTGG - Intergenic
1044617390 8:94156291-94156313 TTAGTTTTCCAGATGACATTTGG + Intronic
1046155106 8:110278590-110278612 TTATTCTTCCACATATCATCTGG - Intergenic
1046576527 8:116036599-116036621 TTTGTTTGTCACATCTCATTGGG - Intergenic
1047690200 8:127344449-127344471 TTAGTATTCCCCATGGCCTTGGG - Intergenic
1052269468 9:26612894-26612916 TTAGGACTTCACATCTCTTTTGG - Intergenic
1053388165 9:37711798-37711820 TTCATATCCAACATCTCATTTGG - Intronic
1053830732 9:42077545-42077567 TTAGAATTCCACATGTAAGTGGG - Intronic
1054599826 9:67109892-67109914 TTAGAATTCCACATGTAAGTGGG + Intergenic
1058010831 9:99975042-99975064 TTAGTATTAAACCTCACATTTGG + Intergenic
1058767818 9:108198878-108198900 TTAGTATTCTACCTCTCCTGTGG - Intergenic
1185790432 X:2924951-2924973 TTAGTAATCCATATCAGATTAGG + Intronic
1186608350 X:11114096-11114118 TTGCTATTGCTCATCTCATTAGG + Intronic
1187199859 X:17124619-17124641 TCAGTATTCTAAATGTCATTTGG - Intronic
1188170934 X:26925278-26925300 TTACTATTGCACAACTCATTTGG + Intergenic
1188292456 X:28406107-28406129 TTACAATTCCACATGTGATTTGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1193724977 X:85027358-85027380 TTAATATTCAACATGTGATTTGG + Intronic
1194981572 X:100446447-100446469 TTACTATTCCATTTCTGATTTGG + Intergenic
1198101344 X:133424778-133424800 TTACTCTTCCACATCTCACCTGG + Intergenic
1200459507 Y:3438366-3438388 TTTGAATTCCACATATCAGTGGG - Intergenic
1201283894 Y:12363017-12363039 TTAGTAATCCATATCAGATTAGG - Intergenic
1202030696 Y:20571440-20571462 TTAGTATGAGTCATCTCATTTGG - Intergenic