ID: 1088338489

View in Genome Browser
Species Human (GRCh38)
Location 11:108736038-108736060
Sequence CATTAACCCTTCAGCAAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088338489 Original CRISPR CATTAACCCTTCAGCAAAGA CGG (reversed) Intronic
904926348 1:34051667-34051689 CATTAACCCCTCACCAGAGGAGG - Intronic
905345423 1:37307944-37307966 AATTAACCCATCATCAAACACGG - Intergenic
906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG + Intronic
910277909 1:85467680-85467702 CTTTCACACTTCAGCAATGAAGG + Intronic
911718595 1:101165215-101165237 TACTTACCCTTCAGCAGAGAAGG - Intergenic
912428183 1:109612687-109612709 CACCAACCCTTCAGGAAAGTAGG + Exonic
920782900 1:209011863-209011885 CATTTATCCTTCAGCAAACAAGG + Intergenic
922413064 1:225394412-225394434 CATTAACCCTAAATAAAAGATGG - Intronic
923504954 1:234597438-234597460 CCTCAACCCCTCAGCAAACATGG + Intergenic
1064836814 10:19541758-19541780 TATTAACACTTTAGCAAAGATGG + Intronic
1065641200 10:27783961-27783983 CATACACCCTTGACCAAAGAAGG + Intergenic
1066216531 10:33293645-33293667 CACTCAGCATTCAGCAAAGAGGG + Intronic
1069194996 10:65540298-65540320 CACTTACTCTTGAGCAAAGAAGG + Intergenic
1069567338 10:69472612-69472634 AATTAACCCTGGACCAAAGAGGG + Intronic
1070453500 10:76585873-76585895 AATCAACCCTGCAGCAAAGTGGG - Intergenic
1071087281 10:81877459-81877481 CATTAACTCTTCAGTGATGATGG + Intronic
1073523974 10:104162262-104162284 CAGTATCCCTAAAGCAAAGAGGG + Intronic
1073935770 10:108630020-108630042 CATTGATCATTCAGCTAAGATGG - Intergenic
1074280955 10:112051055-112051077 CATTACCTCGTCAGCAGAGATGG + Intergenic
1080125632 11:28730050-28730072 TATGAACCCTCTAGCAAAGAGGG - Intergenic
1085187252 11:74586169-74586191 AATTATCCCTTCACCAAAAAAGG - Intronic
1087188282 11:95225905-95225927 CCTTGACACTTCAGCAAATAAGG - Intronic
1087820219 11:102703333-102703355 TATTAACACTTCAACAAAGGAGG + Intronic
1088338489 11:108736038-108736060 CATTAACCCTTCAGCAAAGACGG - Intronic
1099378128 12:81918864-81918886 GATTAATCCTTCAGCCCAGAAGG - Intergenic
1099852605 12:88121362-88121384 CCATACCCCTTCAGCTAAGAAGG - Intronic
1100155466 12:91794807-91794829 AATTAACCCTTGAGCAAGGCAGG + Intergenic
1102708591 12:114905293-114905315 CCTTCAGCCATCAGCAAAGAGGG - Intergenic
1104362432 12:128146526-128146548 TATTACCCCTTCATCACAGATGG - Intergenic
1104456202 12:128914435-128914457 CATGAATCCTTCAGCACAGGAGG - Intronic
1105062257 12:133163250-133163272 CAGTAACTCTCCAGCAAACAAGG + Intronic
1107860885 13:44660100-44660122 CATGAAGCCTTCAGCCAAGCAGG + Intergenic
1113455276 13:110444199-110444221 CTTGGACCCTTCAGCAGAGATGG + Intronic
1114664964 14:24372292-24372314 CATTAACACTTGTGAAAAGAAGG - Intronic
1115106286 14:29765240-29765262 CATAAACACTTCACAAAAGAGGG + Intronic
1118522296 14:66597940-66597962 CATTCACCCTTAACAAAAGAAGG + Intronic
1119671492 14:76522792-76522814 CAAAAACCCTTCAGGAATGAAGG - Intergenic
1119825332 14:77653099-77653121 CATTTTCCCATCAGCCAAGAAGG - Intergenic
1124920381 15:34020503-34020525 CATTAACCCTTTAGTTAACAAGG - Intronic
1124999559 15:34755534-34755556 CATTTACCCTTCAGCCTAAATGG - Intergenic
1126923971 15:53561425-53561447 CTTAAAGCCGTCAGCAAAGAGGG + Intronic
1127284099 15:57517637-57517659 CATTCACACTTCAACACAGAAGG - Intronic
1127812220 15:62574010-62574032 CCTTAACCCTGCACCAAAGATGG - Intronic
1131854121 15:96574619-96574641 CATTAAACATTGATCAAAGATGG - Intergenic
1132232130 15:100192248-100192270 CAATTACCCTTCAGTAGAGAAGG + Intronic
1132782333 16:1634454-1634476 CATTTACCCTTCACCCTAGATGG - Intronic
1134098369 16:11434648-11434670 GATTACACCTGCAGCAAAGATGG + Intronic
1134828331 16:17302723-17302745 CATAAACCCTTCCTGAAAGAGGG + Intronic
1135913008 16:26578451-26578473 GATTAACCTTTCAGCACAGGTGG - Intergenic
1141943167 16:87291962-87291984 AATTAATACTTCAGCAAAGAAGG + Intronic
1142851249 17:2705910-2705932 CAGTAACCCTCCAGCAGACACGG + Intronic
1143154675 17:4828677-4828699 CACTAACACTTAAGCAATGAAGG - Intergenic
1146083645 17:29806688-29806710 CATCAACCAATCAGAAAAGATGG - Intronic
1146833905 17:36094603-36094625 CATGGACCCTTCAGCATGGAGGG + Intergenic
1146848498 17:36201409-36201431 CATGGACCCTTCAGCATGGAGGG + Intronic
1147051017 17:37794986-37795008 TATTAACCCTGAAGAAAAGATGG + Intergenic
1148492490 17:48032328-48032350 CATTCACCCCTCACCAAACAAGG + Intronic
1148851676 17:50558698-50558720 CATTTTCCCCTCTGCAAAGAAGG + Intergenic
1149178187 17:53900725-53900747 GATTATGTCTTCAGCAAAGAGGG + Intergenic
1153050680 18:900767-900789 GATTGACCCTTCAACAAAGGCGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1157142664 18:45126344-45126366 CATTGTCCCTTCAGCAAAACTGG - Intergenic
1159548923 18:69874910-69874932 TATTAACCCTTTAAAAAAGAAGG - Intronic
1159550574 18:69891846-69891868 CATTAGTTCTTGAGCAAAGATGG - Intronic
1160284589 18:77529397-77529419 CCTCAACACTTCAGTAAAGAAGG - Intergenic
926176073 2:10593585-10593607 CATAAACCCTTAAGAAAAAAAGG + Intronic
929575180 2:43047105-43047127 TTTCACCCCTTCAGCAAAGATGG - Intergenic
930382524 2:50649578-50649600 CATCCACCCTCAAGCAAAGAGGG - Intronic
931059256 2:58508668-58508690 CAAGAACCTTTCAGAAAAGATGG + Intergenic
933875838 2:86621468-86621490 CATAAACCAGTCAGCAAACAAGG + Intronic
933971294 2:87471928-87471950 AACTAACTCTTCAGCAAAGAAGG - Intergenic
936322434 2:111478260-111478282 AACTAACTCTTCAGCAAAGAGGG + Intergenic
937539764 2:122934979-122935001 CAATCACCCCTCAGAAAAGATGG + Intergenic
938068666 2:128295123-128295145 CAGTAGCCCTTCAGGACAGAGGG - Intronic
938147108 2:128844576-128844598 CATTAACATTTTAGAAAAGAAGG - Intergenic
941575484 2:167224724-167224746 TATTGACCCTTAAGCCAAGAGGG + Intronic
941684161 2:168430456-168430478 CCCTAAACCTTCAGCAAAGCTGG - Intergenic
943353310 2:186821048-186821070 CATTAACACATGTGCAAAGAAGG - Intergenic
943946737 2:194074641-194074663 CATTAAGCTCTCTGCAAAGAAGG - Intergenic
943983769 2:194592392-194592414 GACTAACACTTCAGAAAAGATGG - Intergenic
945032375 2:205677989-205678011 CATTAAATCTTCTGCAAGGACGG - Intergenic
946999472 2:225437167-225437189 CACTACCTCTTCAGAAAAGATGG - Intronic
948078382 2:235185049-235185071 CATCAACCCTCCACAAAAGATGG + Intergenic
948799375 2:240424639-240424661 CATTAACCCTCAAGCTAAGAAGG - Intergenic
1168963835 20:1886931-1886953 CATTCCCTCTTCAGCAAAAAAGG - Intergenic
1173191921 20:40883352-40883374 CATTCACCCTTGGACAAAGATGG + Intergenic
1173307948 20:41869230-41869252 CCTTGAGCCATCAGCAAAGAAGG - Intergenic
1173926701 20:46786314-46786336 CATTACCCCATCAACAGAGAAGG + Intergenic
1175560865 20:59929079-59929101 CAATAACCCAACAGCAAAAATGG + Intronic
1184195950 22:42928157-42928179 CATAAACCCTTGAGAAAGGACGG + Intronic
1185231610 22:49687096-49687118 CATAAACCCTTCTGCAAACCTGG - Intergenic
949168495 3:969681-969703 CATTAACTTTCCAGGAAAGATGG + Intergenic
950509268 3:13415982-13416004 CAGTCACCCCTCAGCAAAGAGGG + Intronic
953092984 3:39748071-39748093 CATTATCCCTGCAACAAATATGG + Intergenic
953457062 3:43051920-43051942 GACTAGCCCTTCTGCAAAGATGG + Intronic
954915662 3:54146968-54146990 CATGAAAGTTTCAGCAAAGAGGG + Intronic
955338460 3:58106506-58106528 CATTAAGTCTTCAGTAGAGATGG - Intronic
957812113 3:85236409-85236431 AATTAACTCTCTAGCAAAGAAGG - Intronic
958991982 3:100857002-100857024 TATTACCCCTACAGCAAGGATGG - Intronic
959088995 3:101882167-101882189 CATTAAAACTTCTGCAAAAAGGG - Intergenic
959173253 3:102870173-102870195 CATTAAACATTCATCAAAGCTGG - Intergenic
963750257 3:149170663-149170685 CATTAACTCTTTAGCAACAAAGG + Intronic
963890730 3:150633512-150633534 CATTTACGCTTTAGCTAAGATGG + Intergenic
964956037 3:162356973-162356995 AATCATACCTTCAGCAAAGAGGG + Intergenic
967946006 3:194804827-194804849 CATTTACCCTTCAGCTGAGGAGG + Intergenic
971778936 4:31005427-31005449 CATCAACCCTTCTTCAAAAAGGG + Intronic
981686434 4:147459759-147459781 CATTGACCCTTCAGGAAAGTAGG + Intergenic
982404932 4:155009019-155009041 CATGAACCCTTCCTTAAAGATGG + Intergenic
983036158 4:162868598-162868620 GATTAAACCCTCAGCAAAGCTGG + Intergenic
985199817 4:187473641-187473663 CATTTACCCGTCAGCAACAATGG - Intergenic
988117442 5:26914670-26914692 CATTAAACATTCAGTAAAGGTGG + Intronic
994638919 5:102380616-102380638 CATAAAACCTTTAGCAATGAAGG + Intronic
999456740 5:151723184-151723206 CACAAACACATCAGCAAAGATGG + Intergenic
1001131299 5:169065780-169065802 CTCTGTCCCTTCAGCAAAGAGGG + Intronic
1001368066 5:171165053-171165075 CATTGACCCTTCTGCACAGTAGG - Intronic
1001717976 5:173832608-173832630 CATCTACCCTTCAGAGAAGATGG - Intergenic
1004673209 6:17816780-17816802 CATTTACCCTTCAATAAAAATGG - Intronic
1005003507 6:21265704-21265726 CATTAGCCCTTCAACAGAAATGG + Intergenic
1007184765 6:39960074-39960096 GATCAACCCTTCAGCAAAGAGGG + Intergenic
1007823905 6:44583701-44583723 CATGATCCTTTCAGCACAGAAGG + Intergenic
1009333392 6:62454774-62454796 CATTAACACTTGACAAAAGAAGG - Intergenic
1022850871 7:34260526-34260548 CATTAACCCCTGAGTCAAGAGGG - Intergenic
1027975623 7:85150863-85150885 CATTCACCATTCACCACAGAGGG - Intronic
1028122850 7:87076333-87076355 CATGAAGCCATCATCAAAGATGG + Intergenic
1033204384 7:139405102-139405124 CTTAAACACATCAGCAAAGATGG - Intronic
1033998247 7:147379678-147379700 AATTAACTAGTCAGCAAAGAGGG - Intronic
1039383415 8:37107328-37107350 CATTAACCCTGAAGGAAATAAGG + Intergenic
1039450346 8:37668952-37668974 CATGGCCCCTTGAGCAAAGATGG + Intergenic
1041697427 8:60750906-60750928 CCTTAACCTTACAGCAAAGGTGG - Intronic
1041867543 8:62594357-62594379 CATTAGCCATTCTGCCAAGAGGG + Intronic
1044063376 8:87667265-87667287 GATTAGCCCTTGAGAAAAGAAGG + Intergenic
1044146099 8:88715771-88715793 CATTGACTCTTCAGTGAAGAAGG + Intergenic
1044705618 8:95005667-95005689 CATTAACCCTGTAGCAGAGATGG + Intronic
1047012453 8:120686611-120686633 CATTAAGACTATAGCAAAGAAGG + Intronic
1047252192 8:123189095-123189117 CATTTATCTTTCAGCAAACAGGG + Intronic
1048885054 8:138903120-138903142 CATCAACCCTACAGCAAATATGG + Intronic
1051210675 9:14739058-14739080 TATTAAGACTTCAGAAAAGAGGG + Intronic
1054929467 9:70620694-70620716 CCTTATCCTTTCAGCAAAAAGGG - Intronic
1055194522 9:73572293-73572315 GAATAATCCTTCAGCAAAGTTGG + Intergenic
1057281589 9:93716587-93716609 CAGTGACACTTCAGCCAAGAAGG - Intergenic
1058842124 9:108920071-108920093 CCTTAACCCTTCAGTAAAGGAGG - Intronic
1186419890 X:9417140-9417162 CATCAGCCCCTCAGCAGAGAGGG + Intergenic
1187409832 X:19041657-19041679 CAATAACCCTGCAGCCAACAAGG + Intronic
1188505876 X:30884378-30884400 CATTATCCCTTCAAAAATGAGGG + Intronic
1197809021 X:130424885-130424907 AATTTACCCTTAAGCAAAGGGGG + Intergenic
1198974492 X:142320595-142320617 CATTAAACATTCTTCAAAGATGG - Intergenic
1202250712 Y:22869326-22869348 CATAAACCTTTCAGGAAAAAAGG + Intergenic
1202403701 Y:24503075-24503097 CATAAACCTTTCAGGAAAAAAGG + Intergenic
1202467078 Y:25167007-25167029 CATAAACCTTTCAGGAAAAAAGG - Intergenic