ID: 1088338640

View in Genome Browser
Species Human (GRCh38)
Location 11:108737852-108737874
Sequence CCAAAGATATAATAGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088338640 Original CRISPR CCAAAGATATAATAGGAAAT AGG (reversed) Intronic
903926235 1:26832688-26832710 CCAAAACTATACTAGGAACTGGG + Intronic
904121370 1:28200328-28200350 ACACAGAAATAATAGGATATTGG + Exonic
904223765 1:28996776-28996798 CCAAAGATGAAAGAAGAAATCGG + Intronic
905071352 1:35228517-35228539 AAAAAGATAAATTAGGAAATGGG - Intergenic
906225887 1:44120770-44120792 ACAGACATATAATAGGAACTAGG - Intronic
906852243 1:49263446-49263468 CCAACAATACAATAGAAAATAGG + Intronic
907348123 1:53801343-53801365 CCACAGATGTAACAGCAAATAGG - Intronic
909219499 1:72937541-72937563 CAAAAGGTATAAAAGGAATTAGG - Intergenic
909254353 1:73400138-73400160 ACAAAGATTTAATATGAAGTTGG - Intergenic
909853505 1:80499512-80499534 CCTATGATATAATATGAAATAGG + Intergenic
910394709 1:86780420-86780442 AAAGAGATATAATAGGTAATAGG - Intergenic
910613839 1:89175319-89175341 CCATTGCTATAAGAGGAAATGGG - Intronic
911065644 1:93785670-93785692 CCACAGATATAATACAAAATAGG + Intronic
911444524 1:97973848-97973870 TCACAGATATAATAGGAAGTAGG + Intergenic
911926106 1:103834839-103834861 CCAAAGATATAGTTTGGAATGGG + Intergenic
912799465 1:112712060-112712082 CCAAAGAAAGAAAAGGAATTGGG + Intronic
914788519 1:150855118-150855140 CTAAAGAAATAATATGAAATAGG + Intronic
915578692 1:156800088-156800110 CAAAAGGTGAAATAGGAAATGGG - Intronic
916117448 1:161499065-161499087 CATAAGAGATAATAAGAAATTGG + Intergenic
917130641 1:171739045-171739067 CCAAGGATATGTCAGGAAATGGG - Intronic
917923704 1:179771533-179771555 CCAAAGATACAAGAAAAAATGGG - Intronic
918620594 1:186600019-186600041 CCACAGATATTATACTAAATGGG - Intergenic
918687140 1:187431174-187431196 TCAAAGGTATAACAGGAAAAAGG + Intergenic
919472908 1:198000872-198000894 TCAAAGACAAAATGGGAAATTGG - Intergenic
923506035 1:234607861-234607883 ACAAAGAAATAAAAGGAAAAAGG + Intronic
923969727 1:239186344-239186366 CCAAAGATTATATGGGAAATTGG + Intergenic
924272690 1:242350119-242350141 CCATAGATGAAAAAGGAAATGGG + Intronic
924829282 1:247575417-247575439 TCAAAGATGAAATAGGTAATTGG - Exonic
1063857288 10:10269227-10269249 CCAAAGTGATATTAGGAGATGGG - Intergenic
1063924154 10:10961107-10961129 CCAAAGAATTAATTTGAAATTGG + Intergenic
1065484030 10:26219182-26219204 CCAAGAATATAATTGGGAATTGG + Exonic
1065485817 10:26235844-26235866 ACAAAGAAATAAGAGGAATTTGG - Intronic
1065794007 10:29289895-29289917 CCAATGATATATTACCAAATGGG + Intronic
1066712020 10:38246508-38246530 CCATAGATGAAAAAGGAAATGGG - Intergenic
1067858900 10:49823771-49823793 CTAGAGATCTAGTAGGAAATAGG - Intronic
1067928684 10:50537947-50537969 CCAAACATTTAATATGTAATGGG - Intronic
1068056279 10:52015695-52015717 ACAAAGAGATAATTTGAAATTGG - Intronic
1068102373 10:52571899-52571921 TCAAAGAAATACTAGAAAATGGG + Intergenic
1069246356 10:66211913-66211935 CAAAAGTTATAATCTGAAATTGG - Intronic
1069338353 10:67380497-67380519 CCTAAAATATCATAGGTAATAGG + Intronic
1070410060 10:76131243-76131265 ACAAGGATACAATAGGAAAGTGG - Intronic
1071317832 10:84420408-84420430 CCAAAGATAAAATAGTATCTAGG + Intronic
1073662940 10:105497331-105497353 CCAAATATATCATTAGAAATAGG + Intergenic
1073836256 10:107446545-107446567 TCAAAAATATAATAGCAAATGGG + Intergenic
1074275142 10:111994011-111994033 CCAAAGATTTCTCAGGAAATTGG + Intergenic
1074341578 10:112635893-112635915 CCCAGCATGTAATAGGAAATGGG + Intronic
1074473496 10:113748508-113748530 CCAAACAGATGATAGAAAATAGG + Intergenic
1075037033 10:119078221-119078243 CTAATGATATAATATGAAAAAGG + Intronic
1078379831 11:10829922-10829944 ACAAAGAGATAATTTGAAATTGG - Intronic
1079235896 11:18689963-18689985 CCAAGTATATACAAGGAAATTGG + Intergenic
1080002737 11:27368761-27368783 CAAAAGATATAATGAAAAATGGG - Exonic
1080310483 11:30885403-30885425 CCATAGACACAATAGTAAATTGG + Intronic
1081832646 11:46127035-46127057 CCAAAATCATAATTGGAAATGGG + Intergenic
1082873480 11:57965276-57965298 ACAAAAATAAAATAGTAAATAGG - Intergenic
1084606800 11:70177089-70177111 CCAGAGAGACAACAGGAAATGGG - Intronic
1086483306 11:87268664-87268686 CCAAAAAAAAAATAGCAAATAGG - Intronic
1086733767 11:90281218-90281240 GGAAATATAAAATAGGAAATTGG + Intergenic
1087011917 11:93522584-93522606 CCTAAGATATAACAGGGCATAGG + Intronic
1087480374 11:98692912-98692934 ACAAAGAGATAATTTGAAATTGG + Intergenic
1087550006 11:99637089-99637111 CCAAAGAGATACTAGAATATAGG - Intronic
1087593726 11:100226644-100226666 GCAAATATATAATAGAAAAGTGG - Intronic
1088276612 11:108093535-108093557 GCAAAGATATAAAAGTAAACAGG - Intronic
1088336414 11:108709343-108709365 TGAAAGAGATTATAGGAAATTGG + Intronic
1088338640 11:108737852-108737874 CCAAAGATATAATAGGAAATAGG - Intronic
1088551794 11:111020797-111020819 CCATAGACATAATCGGAAAGAGG + Intergenic
1089479649 11:118793642-118793664 CCAAAAGTAGAATATGAAATAGG + Intergenic
1089652107 11:119921127-119921149 CCAGAGATAAAATAGGGGATGGG - Intergenic
1089990991 11:122859613-122859635 ACAAATATATAATTGGAAAAGGG + Intronic
1090605437 11:128418682-128418704 CTAAAGATATAAGAATAAATAGG - Intergenic
1096886951 12:54727536-54727558 ACAAAGAGATAATCTGAAATTGG - Intergenic
1097292064 12:57925570-57925592 CCATTTATATAATAAGAAATGGG + Intergenic
1098727444 12:73985986-73986008 ACAGAGAAATAATAGGAAAATGG - Intergenic
1099130896 12:78829533-78829555 ACATAGATATAAAAGGTAATGGG + Intergenic
1099782335 12:87212712-87212734 TCAAAGATCCAGTAGGAAATGGG + Intergenic
1099799175 12:87435509-87435531 CCAATTATAGAATTGGAAATTGG + Intergenic
1099941465 12:89194216-89194238 CAAAAGAGATAAGAGGAAATAGG - Intergenic
1100097428 12:91058568-91058590 AAAGAAATATAATAGGAAATAGG - Intergenic
1100531302 12:95464014-95464036 CTAAAGAAATAATTGGAGATGGG - Intergenic
1102058429 12:109914157-109914179 CCAAAGAAATCAAAGGAGATGGG - Intronic
1102997048 12:117359336-117359358 CTGAAGATAAAATAGGAAAAGGG - Intronic
1103252642 12:119513708-119513730 GCTAAGATATATTAGGCAATAGG - Intronic
1104513978 12:129406696-129406718 CTAAAGAGATAACAGAAAATGGG + Intronic
1108325842 13:49330260-49330282 CAAAAGTAATAATAGGAAAGTGG - Intronic
1108768322 13:53663084-53663106 ACAAAGATATGATATGAAACTGG + Intergenic
1108896831 13:55340222-55340244 AAAAAGATATTATAGGAAAATGG - Intergenic
1109434259 13:62277963-62277985 ACAAATATATAATAAGAAAGTGG - Intergenic
1109875348 13:68395520-68395542 CTCTAGATATATTAGGAAATAGG + Intergenic
1109922390 13:69082968-69082990 CCAATGGTATAATATGAGATAGG + Intergenic
1111549717 13:89791028-89791050 CCAAAAATTAAATAGGACATGGG + Intergenic
1111695167 13:91614325-91614347 TCAAAAATAAAAAAGGAAATTGG - Intronic
1112081884 13:95981008-95981030 CCACAAATATAAAAGGAAACAGG - Intronic
1112765713 13:102740489-102740511 CAAAAGTTCTCATAGGAAATTGG + Exonic
1112772065 13:102802453-102802475 CAAAAGATATTACAGGAAAATGG - Intronic
1114845495 14:26315628-26315650 CCAGAGAAATAGTTGGAAATAGG - Intergenic
1114877358 14:26737332-26737354 ACAAAGTTATAATAGCAAACAGG + Intergenic
1116296726 14:43120136-43120158 ACAAAGATATAGTTTGAAATAGG - Intergenic
1117672127 14:58118860-58118882 CCAGAGTTTTAATAGGAAACAGG + Intronic
1118242205 14:64071117-64071139 CAAATGATAAAAAAGGAAATTGG - Intronic
1119447955 14:74682304-74682326 CCACAGAAATAATAGGACCTGGG - Intronic
1120508861 14:85387827-85387849 CCATTAATATAATAGGAAAATGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125388498 15:39165570-39165592 CCAAAGTTATAATAGGCAACAGG - Intergenic
1125810665 15:42538420-42538442 CCAAAAAAATAATAAAAAATAGG - Exonic
1131464310 15:92643315-92643337 CCAAAGTCATTATAAGAAATAGG + Intronic
1131664071 15:94551145-94551167 GCAAAGATAAAATTAGAAATAGG + Intergenic
1131874350 15:96788919-96788941 CTAAAGATATACTAGGTACTGGG - Intergenic
1138022917 16:53501141-53501163 CCAAAGAAATAAGAGAAAACAGG + Intronic
1138486359 16:57347077-57347099 CCAAAGAAACAATAGATAATTGG + Intergenic
1138666103 16:58570146-58570168 CCAAAGATACAGGAGGAATTAGG + Intronic
1138968514 16:62115806-62115828 CCAAAGCAAAAATAGGCAATAGG - Intergenic
1139226909 16:65241428-65241450 CCAAAGATATAAGAAACAATGGG + Intergenic
1139258777 16:65571554-65571576 CCAAAGACATAAAAAGAAAACGG + Intergenic
1139467625 16:67162599-67162621 CCAATGATATTTTAGGAACTGGG - Intronic
1145405192 17:22584097-22584119 GCAAAGAGATAATATGGAATGGG - Intergenic
1148290667 17:46445709-46445731 CCAAAGATATGATCAGAATTAGG + Intergenic
1148312858 17:46663414-46663436 CCAAAGATATGATCAGAATTAGG + Intronic
1150074005 17:62177126-62177148 CAAAAGATAAAAGAGCAAATTGG + Intergenic
1150854817 17:68741642-68741664 TCAAAGATTTGATAGGATATTGG - Intergenic
1152603215 17:81275868-81275890 CCAGAGATATAGCAGGAAAGTGG - Intronic
1153417760 18:4868071-4868093 CCAAAAAGATGAGAGGAAATGGG + Intergenic
1154925972 18:20934662-20934684 CTAACGATTTCATAGGAAATGGG + Intergenic
1155574152 18:27226668-27226690 CCAAAGATATTTTAGGTGATCGG - Intergenic
1156664131 18:39384747-39384769 CAAAAAATAAAATATGAAATAGG + Intergenic
1158086793 18:53661044-53661066 CCAGAGAAATAATAGGATGTTGG - Intergenic
1159251123 18:65878169-65878191 CCAAAGATTAAATGGGAAATAGG - Intronic
1165676678 19:37731609-37731631 ACATAGATATTGTAGGAAATCGG - Intergenic
925040079 2:725768-725790 CCACAGATAACAGAGGAAATTGG + Intergenic
925834792 2:7934093-7934115 CTAAAGCTATAATATGTAATTGG + Intergenic
926624073 2:15075601-15075623 CAAAAGATTGAGTAGGAAATTGG - Intergenic
926830216 2:16953857-16953879 TCAAAGATACAATAGCAATTAGG - Intergenic
928188106 2:29133394-29133416 CAAAAAGTATAATAAGAAATTGG - Intronic
928450140 2:31371314-31371336 CCAAACATAAAATGGGAATTAGG - Intronic
928821926 2:35371999-35372021 ACAAACAAATAATAGAAAATTGG + Intergenic
929371520 2:41229725-41229747 CCAAAAATAAAATAGGCAAATGG - Intergenic
929753618 2:44743478-44743500 CAAAAGGTATAATAAAAAATAGG - Intronic
929839367 2:45441357-45441379 CTATGGATAAAATAGGAAATGGG - Intronic
930344285 2:50159385-50159407 CCAATGATAGAACAGTAAATTGG - Intronic
931520750 2:63094441-63094463 CCAAGGATATAATGGTAAACAGG - Intergenic
931644469 2:64409014-64409036 CCAAAAATAGAATATGAATTAGG + Intergenic
931890616 2:66667368-66667390 TCCAAGATATGATAAGAAATGGG - Intergenic
933060025 2:77725472-77725494 CCAATGATATGACAGTAAATGGG - Intergenic
933476691 2:82800255-82800277 CAAACGATATAAAAGGAAGTTGG + Intergenic
933517138 2:83319170-83319192 CCAAATATATGATAGTAAATTGG + Intergenic
933623443 2:84571282-84571304 GCAAAAGTATAATAAGAAATGGG + Intronic
933899378 2:86838134-86838156 CCATTGTTATAATAAGAAATTGG - Intronic
935294474 2:101637037-101637059 CCAAAAATGTACTAGGCAATGGG + Intergenic
936257702 2:110931082-110931104 CAAAAGATAAATTAGGAAATAGG - Intronic
936740976 2:115508323-115508345 CTGAAGATACAATAGAAAATAGG + Intronic
937640299 2:124204057-124204079 CCAAAGATATGATTTGGAATTGG - Intronic
937966046 2:127511824-127511846 CAAAAGAACTAATAAGAAATAGG + Intronic
938914239 2:135918907-135918929 ACAAAGATATAAAAAGAAAAAGG + Intronic
939679562 2:145113813-145113835 CTAAAGAGATAAAAGGAAAGGGG + Intergenic
940597903 2:155818639-155818661 ACAAAGAGATGATATGAAATTGG + Intergenic
940702029 2:157057217-157057239 CTATATATCTAATAGGAAATAGG + Intergenic
941971821 2:171358800-171358822 CCAAAGCGAAAATAGAAAATGGG + Intronic
942477457 2:176343108-176343130 CCATAGATCAAAGAGGAAATTGG - Intergenic
943968639 2:194373241-194373263 ACAAACATTTAATAGCAAATTGG + Intergenic
943988027 2:194647720-194647742 TCAAAGATATGATGGAAAATTGG - Intergenic
944393026 2:199239570-199239592 CCCAAGGTATAATAGGTAAGAGG - Intergenic
944665055 2:201952815-201952837 GCAAAGATAGAAAAGGAAAAAGG - Intergenic
945891097 2:215432217-215432239 CCAGAGAGATCACAGGAAATTGG + Intronic
946174039 2:217911914-217911936 CCACAGAAAGAATAGGAACTGGG + Intronic
946643052 2:221804792-221804814 ATAAAGATATTATAAGAAATTGG - Intergenic
1170157953 20:13285614-13285636 CCAATGGGATAATAGCAAATAGG - Intronic
1173367957 20:42404840-42404862 CCAAAGATATAAAACAAAATTGG + Intronic
1173835329 20:46121499-46121521 CCAAAGATCCCATAGGATATGGG - Intronic
1174923932 20:54735828-54735850 CCAAAGACATAGTAAGAAAGTGG - Intergenic
1176338799 21:5623628-5623650 CCCAAGTCATAATAGGAATTTGG + Intergenic
1176340207 21:5686701-5686723 CCCAAGTCATAATAGGAATTTGG + Intergenic
1176472461 21:7118854-7118876 CCCAAGTCATAATAGGAATTTGG + Intergenic
1176496022 21:7500632-7500654 CCCAAGTCATAATAGGAATTTGG + Intergenic
1176504620 21:7637755-7637777 CCCAAGTCATAATAGGAATTTGG - Intergenic
1177070284 21:16496846-16496868 CCAATGATATAAAAATAAATTGG + Intergenic
1177919555 21:27134051-27134073 CTAAATACATAAAAGGAAATTGG + Intergenic
1178615551 21:34129915-34129937 CAACAGATATAAAAAGAAATGGG + Intronic
1179159717 21:38884306-38884328 CCAAATATATAAGAGTAAAGGGG - Intergenic
1180176279 21:46091647-46091669 CCAGAGATTTAATTGGAAATAGG - Intergenic
1181541675 22:23576427-23576449 TCAAAAAAATAAAAGGAAATGGG - Intronic
1183561788 22:38580778-38580800 TCAAAGATAAAAAAGGAAAGGGG - Intronic
1183799627 22:40151059-40151081 CCAAAGACAAAAGAGGAACTTGG + Intronic
1203239473 22_KI270733v1_random:1159-1181 CCCAAGTCATAATAGGAATTTGG + Intergenic
949526355 3:4908490-4908512 CTGAAGATATAAAATGAAATAGG - Intergenic
950260144 3:11537446-11537468 CCAAACATATCATAGCACATGGG + Intronic
950770259 3:15305607-15305629 CCAAAGCATGAATAGGAAATTGG + Intronic
951763679 3:26172948-26172970 AACATGATATAATAGGAAATTGG - Intergenic
952778937 3:37074756-37074778 CTACAGATATCTTAGGAAATGGG - Intronic
954538356 3:51377924-51377946 CCAAAGAAATATCAGGGAATAGG - Intronic
956488272 3:69743974-69743996 CTAAAGATTTAAGAAGAAATTGG - Intronic
956556564 3:70529929-70529951 CCAAAAATGGAATAGGAATTTGG + Intergenic
957230429 3:77506523-77506545 CCAAATGTATATCAGGAAATGGG - Intronic
958145348 3:89616496-89616518 ACAAAAATATAATAGCTAATGGG - Intergenic
958564574 3:95792979-95793001 ACAAATATATAATAGGCAATTGG - Intergenic
958564683 3:95794714-95794736 ACAAATATATAATAGGCAATTGG + Intergenic
958988587 3:100813563-100813585 CCAAAGATAAAAAATGAAAAAGG - Intronic
959268710 3:104176715-104176737 CAAAAGTTATAATAAAAAATAGG - Intergenic
959390054 3:105762153-105762175 ACAAAGATATGATATGGAATTGG + Intronic
959535695 3:107482556-107482578 CCAAAGGTATAAAAGGACATAGG - Intergenic
962587398 3:136856234-136856256 CCAAAGTTAGAACAGGAAATTGG + Intergenic
963236116 3:142958472-142958494 ACAAAGCTATAATAGGAGACAGG - Intronic
965195003 3:165583355-165583377 TGAAATATATAATAGGTAATGGG + Intergenic
966363234 3:179152123-179152145 CCAAAAATATTAAATGAAATTGG - Intronic
966426299 3:179783426-179783448 ACCATGATATAATATGAAATGGG - Intronic
966793864 3:183696366-183696388 CTCAAGAGATAATAGGAACTGGG - Intergenic
967085324 3:186090082-186090104 CCAAATATCTCAGAGGAAATGGG - Intronic
967608188 3:191473013-191473035 CCAATGATATAAAGGGAAAATGG - Intergenic
969083923 4:4641346-4641368 CCAAAGATACAAAAGGGAAAAGG - Intergenic
970559114 4:17265645-17265667 GCATAGACATAATATGAAATGGG - Intergenic
970736231 4:19171746-19171768 GTAAAGATAAAATTGGAAATGGG - Intergenic
971837717 4:31790110-31790132 CCAAATATTAAATAGGTAATTGG + Intergenic
972463324 4:39327544-39327566 CCAAAGATCTAATAAGAAGATGG - Exonic
973941862 4:55919326-55919348 CCAAAGATATAAGAGGTAGTTGG + Intergenic
974175594 4:58318004-58318026 CCTAAGAGATGGTAGGAAATGGG + Intergenic
974267370 4:59602911-59602933 ACAAAGAGATGATATGAAATTGG + Intergenic
974924206 4:68277533-68277555 GCAAAGAGATAATTTGAAATTGG + Intergenic
975181255 4:71348254-71348276 CCACAGAAATAAAAGGAACTGGG - Intronic
977034347 4:91931043-91931065 TCAAAGCAATAATAGGAAAAAGG - Intergenic
978041726 4:104072691-104072713 ACTAAGAGATTATAGGAAATGGG - Intergenic
978520532 4:109610397-109610419 TAAAAGATATAATAGGAGAGGGG - Intronic
979309772 4:119189416-119189438 CCAATGATATTAGAAGAAATTGG - Intergenic
979449286 4:120851130-120851152 CTACAGAAATAATAGGCAATAGG + Intronic
980408926 4:132389698-132389720 ACAAAGATATAATTTGGAATTGG + Intergenic
980524328 4:133969854-133969876 CAAAAGAGATAAGAGGAAAAGGG - Intergenic
981270259 4:142838464-142838486 CAAAATATAAAATAGGAAAAAGG + Intronic
983248206 4:165312886-165312908 CCAAAGTTATCTTAGGAAATCGG - Intronic
983279003 4:165656762-165656784 AAAAAGAAATAATAGGAATTAGG + Intergenic
983719997 4:170839062-170839084 CCAAGGATTTAATTGTAAATGGG - Intergenic
986755780 5:10834720-10834742 ACAAAGTTATAATAAAAAATTGG - Intergenic
986869297 5:12028411-12028433 ACAAAGAGATAATCTGAAATTGG - Intergenic
987196856 5:15535694-15535716 ACAAAGAGATAATCTGAAATTGG + Intronic
987420288 5:17712132-17712154 CAAAAGAAATAGTAAGAAATTGG - Intergenic
987467451 5:18289350-18289372 GCAAAGATAAAATGGTAAATAGG - Intergenic
987598182 5:20028996-20029018 CAAAGGATATAACAGGAAAATGG - Intronic
988362701 5:30255964-30255986 ACAAATATATAATTTGAAATTGG - Intergenic
988964994 5:36407090-36407112 CCGAAAATGTAATAGGAAAGAGG + Intergenic
989005695 5:36809684-36809706 GAAAAAAGATAATAGGAAATAGG - Intergenic
989624484 5:43416236-43416258 CCAGAGTTATAATAAGGAATGGG + Intergenic
989825055 5:45844058-45844080 ACACAAATATAATGGGAAATGGG + Intergenic
990791238 5:59482559-59482581 TCAAAGAAATAAAAGGAAAAAGG + Intronic
992969847 5:82045152-82045174 CCAAACATAAAATATAAAATTGG - Intronic
993253176 5:85554140-85554162 ACAAAGATATGATCTGAAATTGG - Intergenic
994168645 5:96635242-96635264 ACAAGGAGATAATAGGAAATGGG + Intronic
994513904 5:100745131-100745153 CCAAAGAAATCATAGGTGATAGG + Intergenic
994692069 5:103032184-103032206 ACCAAGATATAATACAAAATAGG + Intergenic
995205709 5:109477979-109478001 GCAATGATTTAATAGGACATTGG + Intergenic
995407552 5:111816970-111816992 ACAAAATTATAATAGGAATTTGG + Intronic
995462237 5:112416441-112416463 TCTAAGATAGAATAGGAAAAAGG + Intronic
995607173 5:113869525-113869547 CCAAGGATATAATAGTACAAGGG + Intergenic
995885454 5:116889191-116889213 CCAAAGACAAAAAAGGAAAGAGG - Intergenic
996453770 5:123656720-123656742 ACAAAGAGATAATCAGAAATTGG - Intergenic
996640887 5:125752159-125752181 CCAGAGACATAATTGGAACTTGG - Intergenic
996658651 5:125972146-125972168 CAAATGAAATAAAAGGAAATTGG - Intergenic
999000694 5:147919647-147919669 CAAGAGATATAACAGGAGATTGG + Intergenic
1001849910 5:174954564-174954586 CCAAAGATGCAAAAGGAATTTGG + Intergenic
1003196492 6:3919649-3919671 CCAAACATAGAAAAGGTAATGGG + Intergenic
1004564650 6:16784736-16784758 CCAAAGGTATGATTAGAAATTGG + Intergenic
1004835581 6:19527937-19527959 CCCAAAATATAATGGGAAACAGG + Intergenic
1005836809 6:29715911-29715933 CCAGTGATAGAATAGCAAATAGG + Intergenic
1006573218 6:35022504-35022526 CCAAAAATACAATAGAAAATAGG - Intronic
1007361636 6:41360802-41360824 CCCAAGATATAATGGAATATAGG - Intergenic
1008204182 6:48632855-48632877 ACAGATATATAGTAGGAAATGGG + Intergenic
1008448350 6:51619673-51619695 CCAAATATGTAATAAAAAATTGG + Intronic
1008728542 6:54452050-54452072 ACAAAGATATAATTTTAAATTGG - Intergenic
1009330549 6:62414370-62414392 CCAAAGCAATTATAAGAAATAGG + Intergenic
1010153369 6:72762905-72762927 CCCAAGATATAATAGTAATTGGG + Intronic
1011802883 6:91037534-91037556 CTGAAGAAATAATAGCAAATTGG + Intergenic
1013665827 6:112347437-112347459 CCAAAGACAGAATAGGACATTGG - Intronic
1014238479 6:118988697-118988719 CCAAATATATCCTAGGAAATAGG - Intronic
1014307913 6:119765566-119765588 TCACAAATTTAATAGGAAATTGG - Intergenic
1014970264 6:127806066-127806088 CTATAGAGATTATAGGAAATTGG + Intronic
1015648898 6:135431362-135431384 AGAAACAAATAATAGGAAATCGG + Intronic
1015715582 6:136188977-136188999 CCAAAGAGATAAATGGAACTTGG + Intronic
1015762163 6:136675483-136675505 AGAAAGATATATTTGGAAATTGG + Intronic
1016263631 6:142205672-142205694 CCAAAATTAGAATAGGAAATTGG + Intronic
1016773107 6:147874251-147874273 TCTAAGATCTAATATGAAATGGG - Intergenic
1018410592 6:163542472-163542494 CCACAGTTTTAATAGGAAGTGGG + Intronic
1019214968 6:170437660-170437682 CCAGAGATATAATGGGAGCTGGG + Intergenic
1022674826 7:32489603-32489625 ACAAAAATATAAGAGGAGATAGG + Intronic
1022826028 7:34014679-34014701 CTTAAGATTTTATAGGAAATTGG + Intronic
1023712642 7:43011356-43011378 CCAGAGAAAAAATACGAAATTGG + Intergenic
1024336911 7:48217952-48217974 CCAGAGCTATAATAGGATTTGGG - Intronic
1029862994 7:103595342-103595364 CGAGAGATATCATAGGAAAAGGG - Intronic
1030265484 7:107616419-107616441 ACAGAGATATTATGGGAAATTGG - Intronic
1030309853 7:108058203-108058225 CAAAACACATAATGGGAAATGGG + Intronic
1031967312 7:128036037-128036059 GCAAAGACATAAAAGGAATTTGG + Intronic
1033393518 7:140951247-140951269 CCAAAGAAAAAATGGGTAATCGG + Intergenic
1033653706 7:143360249-143360271 GCAGGGATATAAGAGGAAATGGG - Intronic
1034006819 7:147482227-147482249 CAGAAGAAATAATAGGAAAGGGG + Intronic
1036143601 8:6231015-6231037 CCAAAGTTAAAATAGGAAAATGG - Intergenic
1038439570 8:27561872-27561894 CCAAAGATGTTATAGGAAAGGGG + Intergenic
1038442123 8:27578486-27578508 CCAAAGATAAAATATTAGATGGG - Intergenic
1039067934 8:33625212-33625234 GCAAAAATAAAAAAGGAAATAGG - Intergenic
1040047555 8:42978955-42978977 TCAAAGATTAAATAGGATATGGG + Intronic
1040844365 8:51821706-51821728 CCAATGATATGATAGAAAGTGGG + Intronic
1042027833 8:64443015-64443037 CGAAAGATAAAATTGAAAATTGG - Intergenic
1043008182 8:74847123-74847145 CCAAAGTTATAAAAGCATATGGG - Intronic
1043808848 8:84709121-84709143 CCACAGAAATAATAGATAATTGG - Intronic
1043909268 8:85841852-85841874 CCAGAGAAATAAGAGTAAATAGG - Intergenic
1044949884 8:97425600-97425622 CCAAAGAAATAATAAAATATGGG - Intergenic
1045002953 8:97894120-97894142 ACAAAGATTTAAAAGGAAGTTGG + Intronic
1045354762 8:101375548-101375570 CCAAAGAAACATTAGCAAATAGG + Intergenic
1046145160 8:110148701-110148723 CCAAAGATATAATACCAAGATGG - Intergenic
1047679559 8:127240463-127240485 TCAAAAATAAAATAGGTAATTGG + Intergenic
1047764475 8:127979379-127979401 GCAAACATATCATAGCAAATGGG - Intergenic
1049863884 8:144920710-144920732 CCAAACATATAATATGAAAAAGG + Intergenic
1050208218 9:3221649-3221671 CCAAAGAAAAAATTGAAAATTGG + Exonic
1050813218 9:9776338-9776360 CAAGAGATATAAGAGGAATTAGG - Intronic
1050960921 9:11729671-11729693 CCATAGAAATAATAGAAAATAGG + Intergenic
1051025769 9:12609074-12609096 TCAAAGGTATAAGAGGAGATTGG - Intergenic
1051153686 9:14115833-14115855 CCAAAGAGAGATTAGGTAATTGG - Intronic
1052190444 9:25655422-25655444 ACAGACATATAATAGAAAATGGG - Intergenic
1055003585 9:71481325-71481347 TCAAATATTTAATTGGAAATGGG - Intergenic
1055390293 9:75814389-75814411 CCAAAGATAACTGAGGAAATGGG + Intergenic
1056124761 9:83524304-83524326 CCAAACATGTAAAAGGAAAGGGG + Intronic
1056963068 9:91143618-91143640 CCAAATATGTATTAGGAACTGGG + Intergenic
1057095186 9:92300355-92300377 CCTAAAATATAATAGGATACAGG + Intronic
1057104029 9:92393925-92393947 CCAAAGATATTATCAGGAATGGG - Intronic
1057629124 9:96705725-96705747 CCCAAGAAACAATAGGATATTGG - Intergenic
1059023108 9:110597492-110597514 TGAAAGAGATAATCGGAAATTGG - Intergenic
1059722789 9:116977593-116977615 CTGAAGATATGCTAGGAAATTGG - Intronic
1059848209 9:118305099-118305121 CCAAAGATAGAATATAAAATAGG - Intergenic
1061462617 9:130752391-130752413 CCAAAGATATTATAGATATTTGG - Intronic
1203422860 Un_GL000195v1:11292-11314 CCCAAGTCATAATAGGAATTTGG - Intergenic
1185631574 X:1519297-1519319 CCAAGGAGATAATTGGAGATCGG - Intronic
1185962771 X:4563822-4563844 CCAAAGAGATAATTGGAAGATGG + Intergenic
1187649339 X:21384265-21384287 ACACCAATATAATAGGAAATGGG - Intronic
1188396624 X:29692708-29692730 CCAAACAGACAATAGGAACTTGG - Intronic
1190626295 X:52341496-52341518 CCAAAGATGCAGTAAGAAATTGG + Intergenic
1192551130 X:72054612-72054634 TCAAAGAGAAAATAGCAAATTGG - Intergenic
1192890369 X:75384071-75384093 CCAAGTATATAATAGGAAAAAGG - Intronic
1193143591 X:78054871-78054893 CCAAAGAGATAATCTGAAACTGG - Intergenic
1193618354 X:83718457-83718479 ACAAATAAATAATAGGAAGTAGG + Intergenic
1195092674 X:101476981-101477003 TTAAAGATATAAAAGGCAATAGG + Intronic
1197674867 X:129318258-129318280 ACAGAGAAATAATAGGAAAAAGG - Intergenic
1199334991 X:146608603-146608625 TCAAAGTAATAATAGTAAATTGG + Intergenic
1199337919 X:146641833-146641855 AGAAAGAGATAATTGGAAATTGG + Intergenic