ID: 1088340785

View in Genome Browser
Species Human (GRCh38)
Location 11:108763925-108763947
Sequence CAGAAAATACAGATTGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 472}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088340785 Original CRISPR CAGAAAATACAGATTGACAA AGG Intronic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
902074485 1:13772557-13772579 CAAAAGATACACATTCACAATGG - Intronic
902282751 1:15386367-15386389 GAGAAAAGACAGCTTTACAAAGG - Intronic
902534452 1:17111394-17111416 CAGAAAAGACAGACTTTCAATGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903954753 1:27017610-27017632 AAAAAAAAAAAGATTGACAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904408196 1:30307524-30307546 CAGAGGATACAGATTCACAGAGG + Intergenic
905406265 1:37734631-37734653 CTGCAACCACAGATTGACAATGG + Intronic
905882122 1:41470780-41470802 CAGAAAAGACAGATTGTTAGAGG - Intergenic
905969495 1:42130770-42130792 TAGAAAACACAGATTGACACTGG - Intergenic
907154625 1:52322333-52322355 CATTAAAAACAGACTGACAAGGG - Intronic
909988834 1:82196384-82196406 AAGAAACTACATATTGAGAAAGG + Intergenic
910369318 1:86499069-86499091 CAGAAAATGGAGTTTGTCAAAGG - Intronic
912023848 1:105141238-105141260 TAGTAAATATAGATTGAAAAGGG + Intergenic
912928661 1:113936099-113936121 AAGAAAATACAGAATCACAATGG - Intronic
914325413 1:146610410-146610432 CAGAAAGTGCAAAATGACAAAGG - Intergenic
915968071 1:160329790-160329812 CACAGAATCCAGGTTGACAAAGG + Intronic
916242673 1:162655735-162655757 TAGAAAACACAGATTGACGCTGG - Intronic
916715174 1:167441716-167441738 CATTAACTACAGCTTGACAAAGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917899344 1:179526700-179526722 CAGAAAATGCTGATTGAAATAGG - Intronic
918474461 1:184908361-184908383 CAGAAAATGCACAGTGCCAATGG - Intronic
918492604 1:185098085-185098107 AAGAAACAACAGATTGAAAATGG + Exonic
918493854 1:185112156-185112178 CAGGAGATACATATTGGCAAGGG + Intergenic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
919722109 1:200849237-200849259 CACAAAAAACTGATGGACAAAGG + Exonic
921171218 1:212551538-212551560 GAGAAAAGAAAGAGTGACAATGG - Intergenic
921902472 1:220465397-220465419 CACAAAATACAAAATGATAAAGG + Intergenic
921975117 1:221193540-221193562 CAGTAAATAAAGACAGACAATGG + Intergenic
922088204 1:222370806-222370828 CAGAAATTAAAGATTGAGGAGGG + Intergenic
923270208 1:232348467-232348489 CACAACATAGAGATTGACACTGG - Intergenic
923367867 1:233280827-233280849 CAGAAGAAACAGATTTACAAAGG - Intronic
1062870916 10:903445-903467 AAGAAAATACATATTCAAAATGG - Intronic
1063314668 10:4990876-4990898 CAGAAAATACAAAATGAAAATGG - Intronic
1063538828 10:6911614-6911636 AACAAAAGACAGATTAACAAGGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1068386751 10:56339068-56339090 CAGAAAATACTTAGAGACAAAGG - Intergenic
1069537261 10:69263853-69263875 TAAAAAATACAGATAAACAAAGG + Intronic
1070385640 10:75921887-75921909 CAGAAAATAGAGGTGGGCAAGGG - Intronic
1071268205 10:83983110-83983132 CAGAAGATACATTTTCACAAAGG + Intergenic
1071380474 10:85054107-85054129 CTGAAATTACAGATTTAAAATGG - Intergenic
1071590245 10:86865769-86865791 CAGGACATACAGTTTGACCAGGG - Intronic
1071681763 10:87713042-87713064 CAGATAAAACAGACTGACATCGG - Intronic
1071749753 10:88461235-88461257 CAGAAATTAAAGGTTGCCAAGGG + Intronic
1073397877 10:103233044-103233066 CAGGAAATTCAGAATGACAACGG + Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1077292529 11:1804542-1804564 TGGAAAACACAGTTTGACAAAGG + Intergenic
1077346695 11:2061804-2061826 CAGAAAACAGAGATTTAAAATGG - Intergenic
1077571627 11:3344247-3344269 AAGAAAATACAAATTCACAATGG + Intronic
1077628677 11:3796386-3796408 CAAAAAATTCAGATTTAGAAAGG + Intronic
1077973453 11:7220963-7220985 CATTAAATACAGGTTGCCAATGG - Intergenic
1078074015 11:8140805-8140827 AAGAAAATACAGACTAACAGCGG + Intronic
1079149269 11:17883223-17883245 TAGAAAATACAGCTGGACCAGGG + Intronic
1079760785 11:24327814-24327836 CATAAATTACAGATTAAGAATGG - Intergenic
1080001717 11:27358202-27358224 CAGAAGAGACAGACTGACAGAGG - Intronic
1081027968 11:38039132-38039154 CAGAAAATTCACCTTGAGAAAGG + Intergenic
1081898047 11:46603974-46603996 CAGAAAACATATACTGACAATGG + Intronic
1082118540 11:48354314-48354336 TAGTAAATTCAGACTGACAATGG - Intergenic
1082211900 11:49514668-49514690 CAGAAAATACACATTTAATAAGG + Intergenic
1082255786 11:50030985-50031007 TAGTAAATTCAGACTGACAATGG + Intergenic
1084838298 11:71822533-71822555 CAGAAAATACAAAATGACGTAGG + Intergenic
1085126464 11:74005781-74005803 CAGAAAATACAGCGGGACTATGG - Exonic
1085348927 11:75785846-75785868 GAGAAAATGCAAATTCACAAAGG + Intronic
1086155598 11:83662298-83662320 AAGTCAATACAGATTGAAAATGG + Intronic
1086325676 11:85696463-85696485 CAGCTATTAAAGATTGACAATGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087416750 11:97866433-97866455 AAAAAAATACAGAATGAAAAAGG - Intergenic
1087968881 11:104454509-104454531 CAGAAATCACACATTGAAAAAGG + Intergenic
1088039171 11:105355840-105355862 CAGAAAACTCAGATTAAGAAGGG - Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1089095243 11:115914851-115914873 AAGAGAATAAAGACTGACAAGGG + Intergenic
1089142113 11:116293738-116293760 AACAAAAGACAGATTAACAAGGG + Intergenic
1091147598 11:133293245-133293267 AAGAAAATAAAGGTTGAAAATGG - Intronic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1092747814 12:11689952-11689974 GCGCAAATACAGATTCACAAGGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093589441 12:20883055-20883077 CAGAAAATATAGTTTGAAACGGG - Intronic
1095132919 12:38565085-38565107 CAGAGAATACACATTCACCAGGG + Intergenic
1095523813 12:43100990-43101012 CAGAAAATAAATATTGAATATGG + Intergenic
1095531144 12:43188322-43188344 AACAAAATACAGAGTGAAAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095920046 12:47520039-47520061 CAGATAACAGAGACTGACAAGGG - Intergenic
1096019085 12:48307288-48307310 CAAAAAAGACAAATTGTCAAAGG - Intergenic
1097478783 12:60094164-60094186 TAGATTATACAGATTGACAAAGG + Intergenic
1099420603 12:82454511-82454533 GAAATAATACAGATTAACAAAGG + Intronic
1099517025 12:83609669-83609691 GAGAAAATTCATAGTGACAAAGG - Intergenic
1099639228 12:85263519-85263541 CTGAAAATAAACAGTGACAAAGG + Intergenic
1100275471 12:93067940-93067962 CAGAAAAAGCAGATTTACTAAGG + Intergenic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1100992939 12:100269239-100269261 CAGAAAAGACAGGGTGACTAGGG - Intronic
1101009492 12:100434790-100434812 CAGAAAACAAAGATTTACTATGG + Intergenic
1102509062 12:113402113-113402135 CAGTTAATTCAGATAGACAAGGG - Intronic
1103897473 12:124282913-124282935 GAGAAAATACAGAGTGACTGGGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107296377 13:38913592-38913614 CAGAAAATAAATATTGCCAGAGG + Intergenic
1108370716 13:49764771-49764793 AAGAAAATGTAGATTGAGAAAGG - Intronic
1108807972 13:54183451-54183473 TAGAAAATGGAGATTGATAATGG - Intergenic
1108977538 13:56467442-56467464 AATAAATTACAGATTGACACTGG + Intergenic
1109902218 13:68789255-68789277 CAGAAAATATATATTAACACAGG + Intergenic
1110894916 13:80737446-80737468 CAGAAAAGACACATTGAAGAGGG + Intergenic
1110927381 13:81171353-81171375 CAGAGAATAAAGATTGATTATGG - Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1112083166 13:95998688-95998710 CATAAAATACAGATAGATATTGG + Intronic
1112236410 13:97641826-97641848 CACAAAAGACTGATTGACATGGG - Intergenic
1113045100 13:106146980-106147002 AATAAAATACAGATTAATAAGGG + Intergenic
1114172734 14:20289748-20289770 TAGAAAAGACAGACAGACAAAGG + Intronic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115367238 14:32572001-32572023 CAGAAAATAGTGAATGAGAAGGG + Intronic
1115466715 14:33723026-33723048 CAGAATATACACATTCACACGGG + Intronic
1115849434 14:37577809-37577831 CAGAAAATAGAGATTGGGAATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116163215 14:41297060-41297082 CAAAAAGTACAAATTCACAATGG - Intergenic
1116219982 14:42071626-42071648 CATAAAATAGAGATTAACCAGGG + Intergenic
1116241104 14:42344164-42344186 CTGAGAATACAGACTGACAAGGG - Intergenic
1116255756 14:42552778-42552800 CAGATTATACAGAGTGAAAAGGG - Intergenic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1117507069 14:56414613-56414635 CAGAAAATAAAGTTGGACAAGGG + Intergenic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG + Intronic
1121490696 14:94357444-94357466 AAAAAAATACAAATTAACAATGG - Intergenic
1122196227 14:100088225-100088247 CAGAATCTACAGACTGGCAAAGG - Intronic
1122357095 14:101129630-101129652 TAAAAAATAGAAATTGACAATGG + Intergenic
1122735481 14:103837415-103837437 TAGAAAATACTGCTTGAGAAAGG - Intronic
1202847796 14_GL000009v2_random:197156-197178 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202917270 14_GL000194v1_random:187696-187718 CTGAAAATAAAGATTAACCAGGG + Intergenic
1123961225 15:25402770-25402792 AAGAAAAGACACATTGAAAAGGG - Intronic
1124021695 15:25931304-25931326 GAGAAAAGACACATTGAAAAGGG - Intergenic
1124601634 15:31137429-31137451 AAGATAATTCAGAATGACAATGG + Intronic
1124601817 15:31139100-31139122 AAGATAATTCAGAATGACAATGG - Intronic
1125448078 15:39779379-39779401 CAGAAAATACAGATAAGCAAGGG - Intronic
1126024633 15:44434032-44434054 TAGAGAAAACAGATTGATAATGG + Intronic
1126718028 15:51542969-51542991 ATGAAAATACAGAATAACAAGGG + Intronic
1126725475 15:51627105-51627127 CAGAAAAGTCACATTGAAAATGG + Intergenic
1126728471 15:51656791-51656813 AACAAAAGACAGATTAACAATGG + Intergenic
1127025699 15:54803562-54803584 CAGAAAACCCAAAATGACAATGG + Intergenic
1127346335 15:58104408-58104430 CAAAAAATAAATATTGACGAGGG - Intronic
1127651661 15:61014597-61014619 GAGAAAATACAGGTTAACTAGGG + Intronic
1127821749 15:62664342-62664364 CAGAAAATACAAAATCAAAAGGG + Intronic
1129146746 15:73655025-73655047 GAGAAAAAACAGATTAACAAGGG - Intergenic
1130004541 15:80082398-80082420 CAGATAGGACAAATTGACAAAGG + Intronic
1130267389 15:82419672-82419694 CAAAAAAAACAGAATGAAAAAGG + Intergenic
1131411499 15:92211512-92211534 CAAAGATTACAGAGTGACAATGG + Intergenic
1131533813 15:93217010-93217032 CAGCAAATATTGATTGACTATGG - Intergenic
1131949964 15:97671425-97671447 AAGAAAATACATATACACAATGG - Intergenic
1133449685 16:5893503-5893525 CAGATAAAACAGATGGACACAGG - Intergenic
1133664097 16:7948372-7948394 CACAAACTATAGATGGACAAGGG + Intergenic
1133910697 16:10063556-10063578 CAGAAAATCCAGATTATCAATGG - Intronic
1133922302 16:10164187-10164209 CAGTAAATATTAATTGACAAAGG - Intronic
1134743386 16:16568777-16568799 CAGAAAATACACCTTGAAAGGGG - Intergenic
1134924172 16:18143684-18143706 CAGAAAATACACCTTGAAAGGGG + Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135501144 16:22996804-22996826 CAGATTATGAAGATTGACAATGG - Intergenic
1135858798 16:26036404-26036426 CAGGAAATACAGATTGGGCAGGG - Intronic
1135894858 16:26390206-26390228 CAGAAAATGAAGACTTACAAAGG - Intergenic
1135918816 16:26629654-26629676 CAGAAGAGACAGTTTGAAAATGG + Intergenic
1136238009 16:28926169-28926191 CAGATAATGCAGTTTGAAAATGG + Intronic
1136717385 16:32292231-32292253 TAAAGAATACAGATTGACAGTGG - Intergenic
1136835760 16:33498485-33498507 TAAAGAATACAGATTGACAGTGG - Intergenic
1137061839 16:35798052-35798074 CAGTAAAGACTAATTGACAAAGG - Intergenic
1138047064 16:53736374-53736396 CAGAAACTACAGATTGATGGTGG - Intronic
1138174570 16:54884918-54884940 GACAAAAGACAGATTAACAAGGG - Intergenic
1138246894 16:55474341-55474363 CAGAACACACACATTTACAAGGG + Intronic
1140008148 16:71100537-71100559 CAGAAAGTGCAAAATGACAAAGG + Intronic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1141419588 16:83904447-83904469 CAGAAAGTACAGTTTTACAAAGG + Intronic
1203009044 16_KI270728v1_random:225543-225565 TAAAGAATACAGATTGACAGTGG + Intergenic
1203145938 16_KI270728v1_random:1798822-1798844 TAAAGAATACAGATTGACAGTGG - Intergenic
1143426391 17:6842497-6842519 GATAAAACACAGATTAACAAAGG + Intergenic
1145107668 17:20133123-20133145 AAGAATATACAGATTACCAATGG - Intronic
1146831668 17:36075054-36075076 AGGAAAATACAGAATGGCAAAGG - Intergenic
1147207336 17:38847032-38847054 CAGAATATAAACAGTGACAAAGG + Intergenic
1149161066 17:53693799-53693821 AAGAGAATACAGAGTGAAAAAGG - Intergenic
1149163564 17:53723901-53723923 TAGAAAATACATATTAAAAAGGG + Intergenic
1149614122 17:57983871-57983893 CAGAAAACTCAGATTGAGGAAGG + Intronic
1149619531 17:58032741-58032763 CATAGAATTCAGAATGACAAAGG - Intergenic
1151861108 17:76762712-76762734 CAGTAAATATTAATTGACAAAGG + Intronic
1153611130 18:6886304-6886326 AAGAAAATACAGAGGGACAAAGG + Intronic
1154071075 18:11151579-11151601 AAGAAAATACAGCTTCAGAAAGG - Intergenic
1154102477 18:11489069-11489091 CAGAAAAAAAAAATTGATAAAGG - Intergenic
1154276993 18:12970398-12970420 AAGAAAAAACAGATGGACAGGGG - Intronic
1155713121 18:28906944-28906966 CACAACATACAATTTGACAACGG + Intergenic
1155859557 18:30880028-30880050 CAGACAATGGAAATTGACAAAGG - Intergenic
1156635302 18:39020756-39020778 CAGAAAATACTGATTTTCAGTGG - Intergenic
1156772416 18:40744813-40744835 CAGAAATTCAAGATTTACAAAGG - Intergenic
1157078786 18:44498747-44498769 CAGAAGATCCAGATAGACACAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158099617 18:53815732-53815754 CTGTAAATACAGATTTAAAATGG - Intergenic
1158152753 18:54390870-54390892 CAGAAAATACAAATTGCCAAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159351214 18:67275573-67275595 CAGCAAATAAAGAATGAAAAAGG - Intergenic
1159522254 18:69541187-69541209 CAGTAAGTACATGTTGACAATGG - Intronic
1159557298 18:69958705-69958727 CACAAAATGCAGATTGATACAGG + Intronic
1159710962 18:71759252-71759274 GAGAAAATAGAGATTCAGAAAGG - Intronic
1161380455 19:3962286-3962308 CAGATAATTCAGACTTACAAAGG - Intronic
1164179776 19:22807928-22807950 AAGAAAATACATAATTACAAAGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166243685 19:41510819-41510841 CAGAATATCCAGAGTGAAAAAGG - Intergenic
1168587531 19:57605644-57605666 GAGAAAACACAGATTTACTATGG - Intronic
925719712 2:6815173-6815195 CAGAAAATACAAACTGGCTAGGG + Intergenic
926078640 2:9964807-9964829 CAGTAAATACAGATTTGCACAGG - Intronic
926622082 2:15055728-15055750 TAGAAAATACAGCATGGCAATGG + Intergenic
926820529 2:16847170-16847192 CAAAAAAAACAGAACGACAATGG - Intergenic
927066239 2:19473766-19473788 AAGAAAATGCAGATTGAGAGTGG - Intergenic
927314422 2:21665425-21665447 CAGGAAATGCAGATTTACATGGG - Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928415352 2:31087160-31087182 CAGAAGACACAACTTGACAAAGG + Intronic
928706922 2:33959816-33959838 CACAAAAAACATATTGAAAATGG + Intergenic
928835843 2:35543873-35543895 CAGACAATACTGATTGTCCATGG + Intergenic
928903904 2:36351392-36351414 CAGAGAAGACAGATTCAGAAAGG + Intergenic
929434229 2:41915192-41915214 CAGAAAGGACAGATTAAGAAAGG - Intergenic
930293485 2:49525342-49525364 CAGATAAAACAAATTGAAAAGGG + Intergenic
931049460 2:58394368-58394390 CAGAAAATACACTTTGAAGATGG + Intergenic
931128065 2:59299484-59299506 CAGAAAACACTGATAGAGAATGG + Intergenic
931426531 2:62176958-62176980 CAGCAAATACAGCTTCACAGGGG - Intergenic
932378120 2:71256187-71256209 GAGAAGATACAGAATGAGAAGGG + Intergenic
932840830 2:75080949-75080971 TAGAAAAGACAGAATGAGAATGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933092739 2:78141813-78141835 CAGAAATTACAGATAGAGAGTGG - Intergenic
933479644 2:82839676-82839698 TCAAAAATACAGATTAACAATGG - Intergenic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
935374240 2:102379090-102379112 AACAAAAGACAGATTAACAAGGG + Intronic
935753392 2:106258683-106258705 CAGTATATACAGTTTGACACAGG - Intergenic
936244535 2:110815409-110815431 AATAAAATACAAATTAACAAAGG - Intronic
936390258 2:112066272-112066294 CAGATAAGACAGATTGATTAGGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
939470935 2:142618343-142618365 TAAAAAATAAAGATGGACAAAGG + Intergenic
939597946 2:144150759-144150781 TAGAAAATACACATTCACTATGG + Intronic
939673244 2:145039770-145039792 TAGAACATACAGATTAACAGAGG + Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
940555652 2:155225344-155225366 AAGAAAATTCAGATTGAACATGG - Intergenic
940716505 2:157230997-157231019 AAAAAAAAAGAGATTGACAAGGG - Intergenic
940813084 2:158267486-158267508 CAGAAAATACAGGTTTTTAAGGG + Intronic
941268571 2:163395875-163395897 CAGAATATAAAAATTGAAAAGGG + Intergenic
941964568 2:171288160-171288182 CAGTAAACACAGCCTGACAAGGG - Intergenic
942706100 2:178774367-178774389 CAGAAAATATAGAAGGAAAATGG - Exonic
942776648 2:179590005-179590027 CAGAAAATACATGTTTAAAAAGG + Intronic
943948053 2:194092785-194092807 CTGAAAATATGCATTGACAATGG - Intergenic
943948079 2:194093013-194093035 CAGTAAATATTAATTGACAAAGG + Intergenic
944225033 2:197341148-197341170 GACAAAATACAGAAGGACAAAGG - Intergenic
944280828 2:197894563-197894585 CATAAAATAAACATTTACAAAGG - Intronic
944944436 2:204666965-204666987 CAGAAGATGCTGATTGACAAAGG + Intronic
944969207 2:204972675-204972697 TAGAAAATACAGCTGGAAAAAGG - Intronic
945752308 2:213803468-213803490 CAGAAGAGACAGAAAGACAATGG - Intronic
946797117 2:223366916-223366938 CAGAAAATACAGATTCTCTTGGG - Intergenic
1168884296 20:1235408-1235430 AATACAATACAGATTGAAAATGG - Intronic
1170143434 20:13147939-13147961 CAGAAAATAGACCATGACAATGG + Intronic
1170306420 20:14943536-14943558 AATAAAATACATCTTGACAAAGG - Intronic
1170427893 20:16253626-16253648 CAGAAAATACAGATTCATCCAGG + Intergenic
1170761853 20:19258041-19258063 CAGAAAACAGAGGTTGATAAAGG - Intronic
1170808431 20:19654454-19654476 CAGAGCATACAGAGTGAGAAGGG - Intronic
1172135175 20:32681788-32681810 CCGTAAATACTGATTGACGAAGG - Intergenic
1172409821 20:34712599-34712621 CAGTCAATACAGTATGACAAGGG - Exonic
1173109483 20:40173318-40173340 CAAACAATACAGAATCACAAAGG - Intergenic
1174742168 20:53025632-53025654 AAGAAAATACAGGTTGACACTGG - Intronic
1174940912 20:54926118-54926140 TAGAATATACAGATAGGCAATGG - Intergenic
1175678209 20:60965392-60965414 CGGAAAATACAAATTCACAGAGG - Intergenic
1175880926 20:62258554-62258576 CAGAAAATACAGATGAGCAAAGG - Intronic
1178192669 21:30303541-30303563 CAAAAAATACAGTATGAAAAGGG + Intergenic
1178456281 21:32755033-32755055 AAGAAAATAGAGCTTCACAAAGG - Intronic
1178968251 21:37145468-37145490 CAGACAATAAATATTGGCAAGGG + Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179196718 21:39171058-39171080 CAGAAACTACAGATGGATGATGG + Intergenic
1179291089 21:40018941-40018963 CAGAAAATACACATTGTTGAAGG - Intronic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1182753774 22:32661926-32661948 CAGGAAATGTAGTTTGACAAAGG + Intronic
1182933667 22:34199306-34199328 TAGAAAATAAAGAATGAAAAAGG + Intergenic
1183612923 22:38922781-38922803 CAGAGAAACCAGACTGACAAGGG + Intergenic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
949256626 3:2055065-2055087 GAAAAAATACAGCTTGAAAAAGG - Intergenic
949362777 3:3249298-3249320 CAGAAGATAGAGCTTGAGAAAGG - Intergenic
949601987 3:5610244-5610266 CAGAAAACAGAAATTAACAAGGG - Intergenic
950937289 3:16852153-16852175 CAGAAAATGGAGATTGCCTACGG - Intronic
951171254 3:19544473-19544495 CAGAAAATTTTGATAGACAATGG + Intergenic
951230077 3:20168517-20168539 CAGAAAGTACAGTTGGACTATGG - Intronic
951437399 3:22680605-22680627 CAGGTTATACAGAGTGACAAGGG + Intergenic
952007905 3:28863512-28863534 CAGAAAGAACAGAATGACAGAGG - Intergenic
952671717 3:35976095-35976117 GAGAAAATAGTTATTGACAAAGG + Intergenic
953020281 3:39108639-39108661 TGGAAACTACAGCTTGACAAAGG - Intronic
953213311 3:40895532-40895554 CAGAAAATACAGAGAGAGAATGG - Intergenic
953287518 3:41626882-41626904 CAGAAAATAGAGAAAGACCAAGG - Intronic
953892109 3:46759005-46759027 AAGCAAATACAGAATGAAAAAGG + Intronic
955776296 3:62437434-62437456 CAGAAAATGCAGATTACCAAGGG - Intronic
956139820 3:66134800-66134822 AAGAAAAGAAATATTGACAAAGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956710328 3:72033317-72033339 AACAAAAGACAGATTAACAAGGG + Intergenic
956974425 3:74563831-74563853 CAGAAAACACACAATGAGAACGG - Intergenic
956987031 3:74712500-74712522 CAGAAGATATTGATTGAAAAAGG - Intergenic
957225635 3:77441839-77441861 AAGAAAACACAAATTTACAATGG + Intronic
958116256 3:89221912-89221934 GAGAAAAAAAAGATTGGCAATGG + Intronic
960055906 3:113276238-113276260 CAGAAGAGGCAGATTGGCAAAGG + Intronic
960440864 3:117686578-117686600 CAGTAAATACAGAAAGATAAGGG + Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960726157 3:120672418-120672440 GACAAAATACAGAAGGACAACGG + Intronic
962098070 3:132312918-132312940 AAGAAAAAAAAGATTTACAATGG - Intergenic
963208534 3:142662321-142662343 GAGAACATACAGAGTGAGAATGG - Intronic
963492348 3:146017253-146017275 CACAAAATACTTATTGATAATGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964336524 3:155660501-155660523 GAGAATACAGAGATTGACAAAGG + Intronic
965392770 3:168125498-168125520 GAGATAATACATATTGGCAAGGG - Intergenic
965959396 3:174410641-174410663 CAGAAAAAAAAAATTGACAGTGG - Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966505950 3:180701921-180701943 CAGAAAATACAGCTCAACATTGG - Intronic
967432985 3:189409977-189409999 AAGAAAATACAGATAGAAATAGG - Intergenic
969779723 4:9390069-9390091 CAGAAAATACAAAATGACTTAGG + Intergenic
971179923 4:24320148-24320170 CAGCAAGTACAGATTTTCAAAGG - Intergenic
972393388 4:38634374-38634396 CAGAAGAAATAGAATGACAAAGG - Intergenic
972850167 4:43039136-43039158 CAGAAAATATAGAGAGAGAAAGG - Intergenic
974219269 4:58945961-58945983 CACAAAATGCACATTGATAATGG + Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
974546086 4:63308621-63308643 AATAAAAGACAGATTCACAAAGG - Intergenic
974653695 4:64789528-64789550 GAGAGAATAAAGATTTACAAAGG + Intergenic
975075747 4:70206947-70206969 CAGAAAATATAAATCAACAAAGG - Intergenic
975665829 4:76733938-76733960 CAGCAAAAACAGAGTGTCAAGGG - Intronic
975717905 4:77223137-77223159 AAGAAAACACAGTTTGACATTGG - Intronic
976490141 4:85661196-85661218 CACAAAATACAGATTGTGACTGG + Intronic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977181722 4:93883223-93883245 AAGAATATACAGACTGAAAAAGG - Intergenic
977341866 4:95769100-95769122 CAGAAAAGAAAGATTAATAAAGG + Intergenic
977983396 4:103353069-103353091 CAGAAAATAGATACTGGCAAGGG - Intergenic
978009688 4:103664743-103664765 TAGAAAATGCATTTTGACAAAGG - Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
978329405 4:107596454-107596476 CAGAAAATACATATGAACTAGGG + Intronic
978767267 4:112416974-112416996 CAGAAAAGACAGATTAATATAGG + Intronic
978933689 4:114349667-114349689 TAGAAAAAACAGATTAAAAATGG + Intergenic
978956562 4:114621270-114621292 CAGTAAATACTTATTGAAAAAGG - Intronic
979214172 4:118142847-118142869 CAGATAATACATATATACAAAGG + Intronic
979353856 4:119679093-119679115 CAGCAAATATAAATGGACAAAGG + Intergenic
979506866 4:121509087-121509109 CAGAAAATTCAAATTAAAAATGG - Intergenic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
980198890 4:129627891-129627913 CACAAAAGACAGATTATCAAGGG - Intergenic
980564475 4:134520902-134520924 TAGAACATACAGTTTGAAAAGGG - Intergenic
980869363 4:138593504-138593526 TAGAAAATTCAGATTGATATGGG + Intergenic
980894154 4:138845375-138845397 TAGAAAACACAGGTTCACAAAGG + Intergenic
981134743 4:141197541-141197563 TAGAAAATACAAATTGTAAAAGG - Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981369027 4:143937076-143937098 CAGAAAATTCTGGTTGACTATGG + Intergenic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
984203332 4:176754942-176754964 CTGAAAATACAGATTGTCACAGG + Intronic
984250234 4:177323242-177323264 CAGAAAAGACAGAATGAGATTGG - Intronic
984777247 4:183492543-183492565 CAGAAAAGAGAGATTCACAAAGG - Intergenic
987797488 5:22648119-22648141 CAGAAGATAAATTTTGACAAAGG + Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988207618 5:28160449-28160471 TAAAAAATACACATTTACAATGG + Intergenic
988392572 5:30655028-30655050 CAATAAATACACATTAACAATGG - Intergenic
989136872 5:38164609-38164631 CAGAGAAACCAGACTGACAACGG + Intergenic
989243142 5:39222883-39222905 CACATAACACAGAGTGACAAGGG - Intronic
989415606 5:41171869-41171891 TTAAAAATACAGACTGACAAGGG - Intronic
989812748 5:45696754-45696776 AAGAAAGTAAAGTTTGACAATGG + Intergenic
991670927 5:69046885-69046907 CTTAAAACACAGATTGCCAACGG + Intergenic
992998870 5:82359772-82359794 CAGAAAGTACAGGCAGACAAAGG - Intronic
993363539 5:87006737-87006759 CAGAAAATATAAACTTACAAAGG + Intergenic
993452546 5:88090433-88090455 GAAAATATACAGATTGCCAAGGG + Intergenic
993538175 5:89114014-89114036 CAGAAAAGATAGTTTTACAAAGG + Intergenic
993955876 5:94232275-94232297 CAGAAAATATAGCCTCACAAAGG - Intronic
994129033 5:96203409-96203431 TAGAAAATACAGGGTTACAAAGG + Intergenic
995030671 5:107477433-107477455 CAGAAAATACATATTGGCAAAGG + Intronic
995217550 5:109612961-109612983 TAGAAAATACAGATGAATAAAGG - Intergenic
995248325 5:109960964-109960986 CAGATAATACAGATTAATATAGG + Intergenic
995256361 5:110051213-110051235 CAGAAAAAAGAAATTGACACTGG - Intergenic
995448961 5:112279360-112279382 CAGAAAATACAGACTCAGAATGG + Intronic
996682026 5:126238138-126238160 CAGAAAACACAGAAAGCCAACGG + Intergenic
996698716 5:126426997-126427019 CATAAAATTCAGAATGAAAAAGG - Intronic
996913865 5:128687673-128687695 CAGAACCTTCAGATTAACAATGG - Intronic
998082330 5:139287118-139287140 GAGAAAATTAAGCTTGACAAAGG - Intronic
999554594 5:152726834-152726856 CAGAAAACACAGACTGAAAATGG - Intergenic
1003411640 6:5868782-5868804 CAGTCAAAACAGATTGACCAAGG + Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003794360 6:9583467-9583489 CTGAAAATAGAGATTTATAATGG + Intergenic
1004101063 6:12611960-12611982 CAGAAAAGACAGACAGACACAGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004595148 6:17092616-17092638 CAGAAAATAAAGGTTGGAAAAGG - Intergenic
1006201431 6:32295579-32295601 CAGAAAGTAAAGTTTGCCAAAGG - Intronic
1007456832 6:41984761-41984783 CAAAAGATAAACATTGACAAGGG - Intronic
1007670981 6:43553571-43553593 CAGAAGACACAGAGAGACAATGG + Intronic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1007835902 6:44673433-44673455 CAGAAATTAATGATTGATAAAGG + Intergenic
1008052475 6:46914290-46914312 CTGAAAATACAGATTTATGAAGG - Intronic
1009604898 6:65854841-65854863 CAGTAAGGACAGATTGGCAAAGG + Intergenic
1009829988 6:68918031-68918053 CAGAATATACAGATTCATAGAGG + Intronic
1009992311 6:70858774-70858796 AAGAAAATACAACTTTACAAAGG - Exonic
1010149798 6:72718181-72718203 CAGTAAATACTGACTGCCAAGGG - Intronic
1010654165 6:78492181-78492203 AAGATAATACAGCTTGAAAATGG + Intergenic
1010704229 6:79088789-79088811 GAGAAAATAAAGAGTAACAAGGG + Intergenic
1010839500 6:80631744-80631766 CAGAAAACCCAAAATGACAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011616813 6:89204855-89204877 AAGAAAATACAGATGCAGAATGG - Intronic
1011893580 6:92196734-92196756 CTGAAAGTGCAGATTGAAAAGGG + Intergenic
1012023813 6:93962516-93962538 CAGAAAGGACAAATTGAGAAGGG + Intergenic
1012105452 6:95151810-95151832 CAGAAAAAATAGATTAACATAGG - Intergenic
1012277641 6:97293253-97293275 CAGAAAATTCAGTTTTAAAATGG + Intergenic
1012493476 6:99808986-99809008 CAGATAACACGGATGGACAATGG + Intergenic
1012809235 6:103936906-103936928 CAAAAAATACAGTTTGGAAAGGG + Intergenic
1012844006 6:104366987-104367009 CAGAAAAGACAGATGGCTAAAGG - Intergenic
1013139317 6:107315717-107315739 AAGAAAATACAGCTTGCCAAGGG + Intronic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015124624 6:129739634-129739656 AAGAAAATACTGAATGAGAATGG - Intergenic
1015553270 6:134434467-134434489 CAAAAAATACAGTATGAAAAGGG - Intergenic
1015641868 6:135343076-135343098 TAGAATATACAGATTCAAAAAGG + Intronic
1016260421 6:142163072-142163094 CAGAAAATCCAAAATAACAATGG + Intronic
1016454615 6:144217460-144217482 CAGAAAACCTAGACTGACAAAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017406405 6:154124101-154124123 GAGGAAAAACAGATTGACAGTGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG + Intergenic
1020375833 7:7485366-7485388 CACAAACTACACATTTACAAAGG - Intronic
1020991625 7:15204002-15204024 AATAAAATCCAGATTGGCAAAGG + Intronic
1021066574 7:16182963-16182985 CAGAAAATACTAAATCACAAGGG + Intronic
1022289244 7:28985389-28985411 TAGAAAATACTGACTGAAAAAGG - Intergenic
1023067864 7:36396851-36396873 CAGCAAATAGAGAGTGAAAAGGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024541026 7:50475305-50475327 AAGATAAGTCAGATTGACAATGG + Intronic
1024870282 7:53956690-53956712 CAAAACTTACAGAGTGACAATGG - Intergenic
1024907904 7:54409795-54409817 CAGAAAAGACACATTGAAGAGGG + Intergenic
1026341987 7:69442400-69442422 CAGAAAACACAGAATGTCAGTGG - Intergenic
1027645364 7:80790702-80790724 CAGAAAGTAAAGATGGAGAAGGG - Intronic
1027665158 7:81035700-81035722 CAGAGAAAACAGATTGAATATGG + Intergenic
1028240117 7:88409926-88409948 CAGAGAATATAGATTGCTAAAGG - Intergenic
1028256552 7:88605420-88605442 CAACAAATACAGATTTTCAAGGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028879164 7:95859989-95860011 AAGAAAATACACATTGAAGAGGG - Intronic
1028921647 7:96316379-96316401 AAGCATATACAGAGTGACAAAGG + Intronic
1028971519 7:96863985-96864007 CAGAAAATAGGGATTTAAAATGG - Intergenic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029789585 7:102828460-102828482 AAGAAAATAAAGGTTGAAAAGGG + Intronic
1030668541 7:112308760-112308782 AACAAAAGACAGATTAACAAAGG + Intronic
1030738731 7:113083629-113083651 CAGAAAATCCAGGTTACCAAGGG - Exonic
1030862193 7:114647529-114647551 CAGAAAATACAAAATGATGAAGG + Intronic
1030867145 7:114713483-114713505 CAGAAAATACAGACTCAGCAGGG - Intergenic
1031628903 7:124022330-124022352 GAGAAAATATAGTATGACAATGG + Intergenic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032281971 7:130511130-130511152 CAGAAAATGCAGTGTGGCAAAGG + Intronic
1032639097 7:133745156-133745178 CAAAAAATATGGAGTGACAATGG - Intronic
1032910334 7:136421421-136421443 AAGAAAATACAAATTTTCAAAGG - Intergenic
1033231994 7:139606450-139606472 TAAAAAATACAGATTCATAAGGG + Intronic
1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG + Intronic
1035947383 8:3980585-3980607 CATAAAAAACAAATTAACAAGGG - Intronic
1036021437 8:4851445-4851467 AAAAAAATAGAGGTTGACAAGGG - Intronic
1036112936 8:5925570-5925592 CAGAAAATAAATATAGAAAAAGG + Intergenic
1036277151 8:7364001-7364023 CAGAAAATACAAAATGACTTAGG + Intronic
1036344185 8:7946342-7946364 CAGAAAATACAAAATGACATAGG - Intronic
1036402736 8:8424877-8424899 CAGCAATCCCAGATTGACAAAGG - Intergenic
1036540665 8:9705557-9705579 CAGAAAAAGCAGATTGGAAATGG - Intronic
1036839528 8:12107113-12107135 CAGAAAATACAAAATGACATAGG - Intronic
1036861318 8:12353354-12353376 CAGAAAATACAAAATGACATAGG - Intergenic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1037005317 8:13771507-13771529 CAGAAAATACAGAATTTCTAAGG + Intergenic
1037118783 8:15258018-15258040 CAGAAAATTCTGCTTGAAAAAGG - Intergenic
1037246370 8:16840231-16840253 CAGAAATTACAGATTTCCATGGG + Intergenic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1043035675 8:75195639-75195661 CAGAAATTAAAGAATGAAAAGGG + Intergenic
1043129602 8:76444705-76444727 CAGAAGGTACAGAATGAAAAGGG + Intergenic
1043524173 8:81078541-81078563 GAGAAAACACACATTGACAAGGG + Intronic
1044914170 8:97094562-97094584 CAGAAAATAAAGAATGAAAATGG - Intronic
1045110475 8:98935380-98935402 CAGAAAATCCAAATTAACATGGG - Intronic
1045551074 8:103172908-103172930 CAAAAAATAATGATTTACAAAGG + Intronic
1045702974 8:104888253-104888275 CAGAAAAAACAGGATTACAAAGG - Intronic
1045958352 8:107936448-107936470 AAGAAAAAACAGAATAACAATGG - Intronic
1046138147 8:110058280-110058302 CACAAAATACAGCTTTAGAAAGG - Intergenic
1046482039 8:114834690-114834712 CATACAATAAAAATTGACAATGG + Intergenic
1047266330 8:123312837-123312859 GAGAAAATACAGAGTGTAAATGG + Intergenic
1047659356 8:127015981-127016003 TATAAAAAACAGATTGAGAAAGG - Intergenic
1047886451 8:129255163-129255185 CAGCAATTCCAAATTGACAAAGG - Intergenic
1048268432 8:133008292-133008314 GATAAAATACAGAGTGACTATGG + Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049523025 8:143104327-143104349 CATAAAGTACAGGTTGTCAAGGG - Intergenic
1050334631 9:4578589-4578611 CAGAAAAGAGAGATTTTCAAGGG + Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051172400 9:14331858-14331880 CAGAAAATATTTATTGAGAAAGG - Intronic
1051955992 9:22694006-22694028 AACAAAATACAGAATTACAAAGG + Intergenic
1051996371 9:23222645-23222667 TACAAAATACAGGTTGAGAAGGG - Intergenic
1054743632 9:68833193-68833215 AAGAAAATAAAGATAGGCAAAGG + Intronic
1055282212 9:74687948-74687970 CAGGAATTACAGGCTGACAATGG - Exonic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056746164 9:89305236-89305258 CAGCAAGAATAGATTGACAATGG - Intergenic
1058331154 9:103762396-103762418 AACAAAAGACAGATTAACAAGGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059716921 9:116921738-116921760 CAGAAAAGACACAGTGAGAAAGG + Intronic
1059761567 9:117342688-117342710 CTGAAAACACAGTTTGAAAATGG - Intronic
1059879646 9:118676157-118676179 CAGAATATATAGATTGAGAGTGG + Intergenic
1186189115 X:7052014-7052036 AAGAAAATGCAGAGGGACAAAGG - Intronic
1186362814 X:8860592-8860614 CACAGAATACAGAATCACAAAGG + Intergenic
1186911096 X:14167257-14167279 AATAAAATACAGACTGAAAATGG - Intergenic
1187019645 X:15367189-15367211 AGGAAAATACAGAATGACATGGG + Intronic
1187667139 X:21626725-21626747 CAGAAAACACAAATTTAGAATGG + Intronic
1188029736 X:25251185-25251207 CAGAAAAAAAAAATTGGCAAAGG - Intergenic
1188120694 X:26303735-26303757 CAAAAAATACATTTTAACAAAGG + Intergenic
1188197503 X:27255547-27255569 AAGAAAACAAAGATGGACAAAGG - Intergenic
1188202716 X:27310888-27310910 CAGAAAATACAGTTTAAAATGGG - Intergenic
1188479921 X:30627078-30627100 CAGGAAATACAGCTTTATAAAGG + Intergenic
1188911646 X:35855335-35855357 CAGAAAATAATGATTGCCACTGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191733239 X:64361062-64361084 AACAAAATACAGAATGAAAAAGG + Intronic
1191744416 X:64470361-64470383 TAGAAAAGACAGAGTGAGAAGGG + Intergenic
1191767599 X:64715337-64715359 CAGAAACAACAAAATGACAAGGG + Intergenic
1193254887 X:79336654-79336676 CAGAAAATACAGACTGTCCCTGG - Intergenic
1194128048 X:90044683-90044705 AACAAAAGACAGATTAACAATGG + Intergenic
1194603265 X:95949663-95949685 CAGAAAATAAAGGTGGATAAAGG + Intergenic
1196197688 X:112853187-112853209 CAGAAAATACATTTTAACAGAGG - Intergenic
1196345241 X:114648193-114648215 CTGAAAATACAGAGTCACAGAGG - Intronic
1196364548 X:114909939-114909961 CAAAAAATACCATTTGACAAAGG - Exonic
1196430797 X:115623153-115623175 CAATAAATACAGACTGAAAATGG - Intronic
1196668060 X:118337174-118337196 AAAAAAATAAAGATTGACATTGG + Intergenic
1198583436 X:138093403-138093425 AAGAAAATACAGTTTCAAAAAGG - Intergenic
1201259195 Y:12141295-12141317 AAGAAAATACAGATTAAGGATGG + Intergenic