ID: 1088341729

View in Genome Browser
Species Human (GRCh38)
Location 11:108776315-108776337
Sequence TGTCAGCCAAGAATTTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088341727_1088341729 -1 Left 1088341727 11:108776293-108776315 CCACTTGCACGTGCATTTCAGCT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1088341729 11:108776315-108776337 TGTCAGCCAAGAATTTGTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 250
1088341726_1088341729 12 Left 1088341726 11:108776280-108776302 CCTTGGAGTTTTGCCACTTGCAC 0: 1
1: 1
2: 0
3: 9
4: 138
Right 1088341729 11:108776315-108776337 TGTCAGCCAAGAATTTGTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088341729 Original CRISPR TGTCAGCCAAGAATTTGTGG AGG Intronic
900494901 1:2971945-2971967 AGTCAGCCACCACTTTGTGGTGG - Intergenic
901380994 1:8874172-8874194 TGTCAGCCAACAACTAGTGATGG + Intronic
902283192 1:15389187-15389209 TGTAATCCCAGAATTTGGGGAGG + Intronic
903036377 1:20495436-20495458 TGACAACCCAGAATTTGTGCTGG + Intergenic
903688742 1:25153906-25153928 TGTGAGCCAAGAAATGGAGGTGG - Intergenic
903797760 1:25942809-25942831 TGTCATCCCAGCACTTGTGGAGG + Intergenic
904140668 1:28350512-28350534 TGTAATCCCAGAATTTGGGGAGG - Intergenic
906207805 1:43996399-43996421 TGTCTGCCAGGCCTTTGTGGAGG - Exonic
908832390 1:68192358-68192380 TGTAAACCAAAAATTTGGGGAGG + Intronic
908918846 1:69166078-69166100 TGTCAGGTAAGACTTTTTGGAGG + Intergenic
909799501 1:79788417-79788439 TGTAATCCTAGAATTTGAGGAGG + Intergenic
911188255 1:94925222-94925244 TGCCAGCCAAGAATCACTGGGGG + Intronic
913126004 1:115790984-115791006 TGTAGGCCAATAATTTGTTGTGG + Intergenic
913543423 1:119843351-119843373 TCGCACCCAAGAATGTGTGGAGG - Intergenic
913547494 1:119883839-119883861 TATCAGCCAAGAATTGGGGAGGG + Intergenic
914723747 1:150310324-150310346 TGTCAGCCAACCAATGGTGGAGG - Intergenic
914940572 1:152019449-152019471 CGGCACCCAAGACTTTGTGGAGG + Intergenic
915590142 1:156866182-156866204 AGCCAACCTAGAATTTGTGGTGG - Intronic
916026497 1:160837846-160837868 TGTCATCCAAGAATTAGAAGAGG - Intronic
916781814 1:168040318-168040340 GGTCAGCCAGGAAATTGAGGAGG + Intronic
917971636 1:180211699-180211721 TGGTAGGGAAGAATTTGTGGTGG - Intergenic
921150445 1:212397753-212397775 TATCAGCAAAGACTCTGTGGAGG + Intronic
921742726 1:218705085-218705107 AGTCAGCCAAGTATGTGAGGTGG - Intergenic
922114071 1:222592422-222592444 TGTGAGTCAGGAATTTGTGTAGG - Intergenic
924268030 1:242302459-242302481 TGTAATCCAAGCATTTTTGGAGG + Intronic
1064297919 10:14094952-14094974 TGTCAACCAAGAGTGTGGGGGGG + Intronic
1064930689 10:20622645-20622667 TGTGAGGCAACAATTTGTAGAGG - Intergenic
1066508737 10:36071800-36071822 TGTCATCCCAGAACTTTTGGAGG - Intergenic
1066576493 10:36831619-36831641 TGTAATCCAAGCATTTGGGGAGG + Intergenic
1069326781 10:67240812-67240834 TGTCAGTCAAGAAAATGTAGGGG + Intronic
1076092111 10:127695515-127695537 TGTTCGCCAAGAATTTGAGTGGG + Intergenic
1077128525 11:956871-956893 TGTGACCCCAGAATATGTGGGGG + Intronic
1077370994 11:2181616-2181638 TGTAATCCCAGAATTTGGGGAGG - Intergenic
1078810182 11:14752675-14752697 TGTCAGCTCAGAGTTTGTGATGG - Intronic
1079796174 11:24805858-24805880 TGTCATCCAAAAATTTCTGTAGG - Intronic
1080257534 11:30307551-30307573 ACTCAGCCATGAATTTGTGATGG + Intergenic
1080309995 11:30878801-30878823 TGGGAGCCAAGGATTTGTGAGGG - Intronic
1080846815 11:36034034-36034056 TGTCAGCAAAGACTCTGTGCAGG - Intronic
1081890730 11:46540086-46540108 TGTCATCCAAGAACTTTGGGAGG - Intronic
1081995854 11:47363607-47363629 TGTAATCCAAGCATTTGGGGAGG - Intronic
1082897942 11:58213046-58213068 TGTAAGCCAAGCATTTCAGGAGG + Intergenic
1086512097 11:87570017-87570039 TGTAATCCCAGAATTTGGGGAGG + Intergenic
1086660988 11:89416975-89416997 TGTCATCCAAACATTTGAGGAGG + Intronic
1088341729 11:108776315-108776337 TGTCAGCCAAGAATTTGTGGAGG + Intronic
1088434232 11:109793255-109793277 TGTTTTCCATGAATTTGTGGTGG + Intergenic
1088483608 11:110320115-110320137 TGTCAGCCCAGACAGTGTGGAGG - Intergenic
1088645386 11:111912962-111912984 GGTCAGCCCAGAATTTCAGGGGG - Intronic
1089398071 11:118148730-118148752 TGTCAGCCAAGAATGTCTCCAGG + Intronic
1089712128 11:120323165-120323187 TAACAGCCCAGAATTTCTGGGGG + Intergenic
1089846105 11:121459882-121459904 GGTCAGCCAAGAAGTGGGGGAGG - Intronic
1090541633 11:127712360-127712382 TGTGAGACATGAATTTGTGAGGG - Intergenic
1092814697 12:12302572-12302594 TTTCTGCCAACAATGTGTGGGGG - Intergenic
1092935888 12:13363947-13363969 TGTAATCCCAGAATTTGGGGAGG - Intergenic
1093407731 12:18825474-18825496 TGTCAACCAAAAATGTGTGCAGG + Intergenic
1094713205 12:32986027-32986049 TGTCAGCAGGGAGTTTGTGGAGG + Intergenic
1095431795 12:42142598-42142620 TGTAATCCCAGAATTTGGGGAGG - Intronic
1096057455 12:48666293-48666315 TGTAAGCCCAGCATTTGGGGAGG + Intronic
1096325246 12:50654606-50654628 TGTAATCCAAGCATTTGGGGAGG - Intronic
1096890094 12:54760774-54760796 TGTAATCCCAGAATTTTTGGAGG - Intergenic
1100092961 12:90994138-90994160 TGAGAGCCAAGAATTTGGGAAGG - Intronic
1100931257 12:99612311-99612333 TGTTAGCCATTATTTTGTGGTGG - Intronic
1101244325 12:102871060-102871082 AGTCAGGCAAGAAATGGTGGTGG - Intronic
1101921506 12:108936938-108936960 TGTAATCCCAGAATTTGGGGAGG + Intronic
1102264142 12:111467409-111467431 TGTAATCCAAGAACTTGGGGAGG - Intronic
1102641297 12:114369205-114369227 TCTCAGCCAACATTTTTTGGAGG - Intronic
1102754510 12:115326602-115326624 TGTCATCCCAGCATTTTTGGAGG - Intergenic
1102764346 12:115419100-115419122 CCTCAGCCAAAACTTTGTGGGGG - Intergenic
1103136177 12:118509818-118509840 TATCAGCCAAGAGCTGGTGGGGG - Intergenic
1103171132 12:118820996-118821018 TGTAATCCCAGAATTTGGGGAGG - Intergenic
1105056095 12:133100430-133100452 TGTCATCCCAGAATTTTGGGAGG - Intronic
1106414246 13:29533024-29533046 TGTTAGCCAGGTATTTGTAGTGG + Intronic
1107123683 13:36821402-36821424 TGTAAGCCCAGAACTTGGGGAGG + Intronic
1107161498 13:37234004-37234026 TGTCATCCAGGAATGTGGGGAGG - Intergenic
1108681380 13:52783530-52783552 AGTCAACCAGGAATATGTGGAGG - Intergenic
1109263356 13:60168889-60168911 AATAAACCAAGAATTTGTGGAGG - Intergenic
1112757290 13:102651595-102651617 AGTCATCCAGGAATTTATGGTGG - Intronic
1112947875 13:104954707-104954729 TGTCAGCCAAGAAGTAGGGAAGG + Intergenic
1113291163 13:108908041-108908063 TTTCAGCAAAGAATTTAAGGGGG + Intronic
1113589314 13:111487037-111487059 TTTCACCCAAGCAGTTGTGGGGG - Intergenic
1113604079 13:111592419-111592441 TGTCCGCTAAAACTTTGTGGTGG - Intronic
1117696060 14:58363993-58364015 TTTGTGCCAAGAATTTGAGGGGG - Intronic
1118757123 14:68853162-68853184 TGTAATCCCAGAATTTGGGGAGG - Intergenic
1121889403 14:97574825-97574847 TCTCAGCCATGAATCTGTAGGGG + Intergenic
1123190210 14:106562140-106562162 TGTCATCCCAGCATTTGGGGAGG - Intergenic
1123908074 15:24940044-24940066 TGTAAGCCTAGCATTTGGGGAGG - Intronic
1126655970 15:50977963-50977985 TGTAATCCCAGAATTTTTGGAGG - Intronic
1126846335 15:52764144-52764166 AGTCTGCCAAGAATTTGTCTGGG + Intronic
1126950178 15:53872195-53872217 GAGCAGGCAAGAATTTGTGGTGG + Intergenic
1128344776 15:66846640-66846662 TGTAATCCCAGAATTTTTGGTGG - Intergenic
1131281600 15:91025661-91025683 TGTAAGCCCAGAATTTTGGGAGG - Intergenic
1134489891 16:14688800-14688822 TGTAATCCCAGCATTTGTGGAGG - Intronic
1134495272 16:14727917-14727939 TGTAATCCCAGCATTTGTGGAGG - Intronic
1134500661 16:14767043-14767065 TGTAATCCCAGCATTTGTGGAGG - Intronic
1134527199 16:14953650-14953672 TGTAATCCCAGCATTTGTGGAGG - Intergenic
1139726089 16:68899853-68899875 TGTAATCCCAGAATTTTTGGAGG - Intronic
1139823301 16:69737763-69737785 TTCCAGCCAAGTATTTCTGGGGG + Intergenic
1140450615 16:75068095-75068117 TGTAATCCAAGCATTTGGGGAGG + Intronic
1140826953 16:78715731-78715753 TGTAATCCCAGAATTTGGGGAGG - Intronic
1141722985 16:85767203-85767225 TGTAATCCCAGAATTTTTGGAGG - Intergenic
1142225679 16:88876512-88876534 TTTCAGCAAAGAATTTTGGGGGG - Exonic
1142242225 16:88952807-88952829 GGTCCGCCAAGTATTTGTTGAGG - Intronic
1144010886 17:11147461-11147483 TCTCATCCCAGAATTAGTGGAGG - Intergenic
1149253844 17:54801724-54801746 GGTCAGCCAAGCATTTGAAGGGG - Intergenic
1151307970 17:73275714-73275736 AGTCAGCCCAGATTTGGTGGAGG + Intergenic
1154134729 18:11766236-11766258 TGTCATCCATGAAGGTGTGGGGG + Intronic
1155737382 18:29240427-29240449 TGTAAGCCAAGCATTTTGGGAGG - Intergenic
1158796367 18:60850778-60850800 TGGCAGGCAAGAATGTGTGCAGG + Intergenic
1159087614 18:63811530-63811552 TGTTAGCTAATAATTTGTTGGGG + Intergenic
1159197834 18:65141525-65141547 TGGCACCCAAGGTTTTGTGGTGG - Intergenic
1159849549 18:73511178-73511200 TGTCTGTCCAGAATTTGGGGTGG + Intergenic
1160005723 18:75067855-75067877 TTACAGCCAAGAAGTTGTGGGGG + Intergenic
1162532314 19:11243104-11243126 TGTCAGCCAGGAACTTGAAGAGG + Exonic
1165310081 19:35024464-35024486 TGTCAGGCCAGCAGTTGTGGTGG + Intronic
1165821412 19:38678716-38678738 TGACAGCGAAGAAGGTGTGGAGG - Intronic
1165914532 19:39249504-39249526 TGTAATCCAAGAATTTTGGGAGG - Intergenic
1166931214 19:46302615-46302637 TGTAATCCCAGAATTTGGGGAGG + Intronic
1167869644 19:52357258-52357280 TGTAACCCAAGAATTTTTGGAGG + Intronic
926008418 2:9390281-9390303 TGTCAGCCTTGCATTTGGGGCGG + Intronic
926033516 2:9614421-9614443 TTTTAGCCATTAATTTGTGGAGG + Intronic
932280770 2:70489886-70489908 TCTCAGCCTACAATGTGTGGAGG - Intronic
933147819 2:78876885-78876907 TGTCAGCCTGGTATTTTTGGGGG - Intergenic
933889756 2:86756866-86756888 GGCCAGCCAAAAATTTGAGGTGG + Intronic
934037335 2:88099466-88099488 TGTAATCCCAGAATTTCTGGAGG + Intronic
934687481 2:96332442-96332464 TGGCAGCCTAGGATTAGTGGAGG + Intergenic
937093362 2:119221356-119221378 TTTCAGCCAAGACTTGGAGGAGG + Intergenic
937432248 2:121848724-121848746 TGTCAGGCAAGGATATGTGAGGG - Intergenic
938772836 2:134514940-134514962 TGTAAGCCAAGGTTTGGTGGTGG - Intronic
939075008 2:137589034-137589056 TGTAATCCCAGCATTTGTGGAGG - Intronic
939592585 2:144083453-144083475 TGTGAGTCAAGAATTTGGGTAGG - Intronic
940479911 2:154215027-154215049 TGTAAGCCAAAAGTTTCTGGTGG + Intronic
942095691 2:172534835-172534857 TGTCAACCAAGACTTTGCTGTGG + Intergenic
1168978328 20:1984553-1984575 CATCTGCCAAGAATTTATGGAGG - Intronic
1169884949 20:10388915-10388937 TGTAAGGCACGAATTTCTGGTGG - Intergenic
1170746929 20:19107850-19107872 TGTCTGCCAAGTGTTTGTGTAGG - Intergenic
1171124757 20:22591772-22591794 TGTCAGTCCAAATTTTGTGGAGG - Intergenic
1174438488 20:50529367-50529389 TGTTAGCTATGATTTTGTGGTGG + Intronic
1174625104 20:51907728-51907750 TGTAATCCCAGAATTTGTGGGGG + Intergenic
1178334983 21:31734570-31734592 TGTAATCCCAGAATTTTTGGAGG + Intergenic
1183169099 22:36171809-36171831 TGTCATCCAAGAACTTTGGGAGG - Intergenic
1185057766 22:48589890-48589912 TTTAAGCCACGAGTTTGTGGTGG + Intronic
949711799 3:6879515-6879537 TGTCAGCCCAGGCTTTCTGGAGG + Intronic
953063767 3:39450517-39450539 TGTAATCCAAGCATTTGGGGAGG - Intergenic
953717466 3:45328284-45328306 TGCCAGCCAAGAATTTTCTGAGG - Intergenic
956754641 3:72372894-72372916 TAACAGGGAAGAATTTGTGGAGG - Exonic
956963614 3:74432985-74433007 TGTCACCCAAGTCTTTTTGGAGG - Intronic
956998767 3:74859325-74859347 TGCCAGGCTAGAGTTTGTGGTGG + Intergenic
957673343 3:83334111-83334133 TGTCATCCATGGATTTATGGGGG - Intergenic
957808270 3:85180858-85180880 TGTCAGCCAAAACTTTTTTGTGG - Intronic
959299601 3:104580172-104580194 GGACAGCCCAGAATCTGTGGAGG - Intergenic
959934791 3:112018087-112018109 TGTAATCCCAGAACTTGTGGAGG - Intergenic
960346187 3:116536075-116536097 TGTCAGCCCAAAATTTGGGGAGG + Intronic
961415712 3:126755125-126755147 TGCCAGCCAAGAACATGAGGAGG + Intronic
964167880 3:153731014-153731036 TGTCAGCCCTTAATTTATGGAGG - Intergenic
964337626 3:155673215-155673237 AGTCAGCAAAGGATTTCTGGAGG - Intronic
965551416 3:169968452-169968474 ACTCAGCCAATAATTGGTGGAGG - Intronic
965590111 3:170355024-170355046 TGGCAGCCAAGAAGGTGAGGTGG + Intergenic
966194320 3:177298186-177298208 TGTCAGCAGAGAGTTTGTGGAGG - Intergenic
966269559 3:178088533-178088555 TGTAAGCCAAGACTTTGTGAAGG + Intergenic
967186464 3:186948717-186948739 TGTGGGCCATGAATTTGAGGGGG - Intronic
967475233 3:189908807-189908829 TATCAGCCAGGAATGTGGGGAGG + Intergenic
967810092 3:193751900-193751922 TGTTATCCAAGAATTTTGGGAGG - Intergenic
969994795 4:11301220-11301242 TGTGAGCCAGGAATCTGTGTAGG + Intergenic
970462533 4:16289532-16289554 TTTCAGCCAACAATTTCAGGGGG - Intergenic
971449645 4:26787948-26787970 TGTCAGCCGAGAGTTTCTGTAGG - Intergenic
971465380 4:26953121-26953143 TGTCAGTAAAGAAACTGTGGTGG + Intronic
971672138 4:29575233-29575255 TGTCACCCAATTACTTGTGGAGG - Intergenic
971824813 4:31607349-31607371 TGGCAGCCAACAATGTGTCGGGG - Intergenic
972775945 4:42240594-42240616 AGGAAGCCAAGAATTTCTGGAGG - Intergenic
973110679 4:46393664-46393686 TGTCAGCTAAGAATTTGCACCGG - Intronic
975016962 4:69433841-69433863 AATCAGCCAATAATTTGTGAAGG + Intergenic
976447785 4:85151467-85151489 TGTCAGCAGAGAATTCTTGGTGG + Intergenic
977117267 4:93045879-93045901 TCTAAGCCAAGTATTTATGGGGG + Intronic
979200377 4:117971058-117971080 TGTAATCCCAGAATTTGGGGAGG + Intergenic
979937012 4:126710467-126710489 TGTGAGACAAGCATTTGTGTGGG - Intergenic
982834442 4:160106282-160106304 TGTCAGTCTATAAATTGTGGGGG + Intergenic
983276736 4:165627073-165627095 TGACGGCCAAGAATTTGTACAGG + Intergenic
987963646 5:24844103-24844125 TATCAGCCAAGAATTAGAGCTGG + Intergenic
989740284 5:44762898-44762920 TGGCGGACAAGTATTTGTGGTGG + Intergenic
991284356 5:64954539-64954561 TGTAATCCCAGAATTTGGGGAGG - Intronic
993740077 5:91528093-91528115 TGTGATCCAAGAATTTTGGGAGG - Intergenic
993746842 5:91610690-91610712 TGTCAGCCAAGGTTTTCTGCTGG - Intergenic
995732100 5:115256575-115256597 TGTCTGCCAAGCATTTCTGATGG - Intronic
997387241 5:133483143-133483165 TGGCAGGCAAGAGTTTGTGCAGG - Intronic
998455380 5:142268776-142268798 TATCAGCCAGGTATTTGTAGAGG + Intergenic
998743265 5:145229001-145229023 TGTCAGCAGGGAGTTTGTGGAGG + Intergenic
998867174 5:146517130-146517152 TGTAATCCCAGAATTTGGGGAGG + Intergenic
999371710 5:151059479-151059501 TGTCAGCCAAACCTTTGTGAAGG + Intronic
999722678 5:154410592-154410614 TGTTAGCCAAGAACTTATGAAGG - Intronic
999950164 5:156640684-156640706 CGTCAGACATGATTTTGTGGGGG - Intronic
1000317319 5:160104983-160105005 TGTAATCCAAGCATTTCTGGAGG + Intronic
1000378988 5:160611929-160611951 CATCAGCCAAGAAGATGTGGTGG + Intronic
1001466570 5:171972219-171972241 TGTAATCCCAGAATTTGGGGAGG + Intronic
1002857328 6:1049932-1049954 TGTCAGCGAAGGATTTCTGGAGG + Intergenic
1003468337 6:6403106-6403128 TCTCAGACAAGAAATGGTGGTGG + Intergenic
1004856553 6:19757250-19757272 AGTCAGGGAAGATTTTGTGGGGG - Intergenic
1006992112 6:38223954-38223976 TGTAATCCCAGAATTTTTGGAGG + Intronic
1009331166 6:62422522-62422544 AGTCAGCCAATAATTTGAGCTGG + Intergenic
1010251531 6:73712238-73712260 TGTTTTCCATGAATTTGTGGGGG + Intronic
1010490230 6:76466997-76467019 TGCCAGCTAACAGTTTGTGGAGG - Intergenic
1011964436 6:93136421-93136443 TGTGAGCCAAGACTTTCAGGAGG - Intergenic
1014284926 6:119486540-119486562 TGTCATCCAAGCATTTTGGGAGG + Intergenic
1015485129 6:133761096-133761118 GGTCAGCCAAGATTTTATGGAGG - Intergenic
1018830895 6:167442755-167442777 TGTCAGCCATGAAATTTTGTAGG - Intergenic
1020019690 7:4856063-4856085 TGTAAGCCAAGCATTTTGGGAGG - Intronic
1021188127 7:17589138-17589160 TATCAGAGAATAATTTGTGGAGG + Intergenic
1021236609 7:18149951-18149973 TGTAATCCCAGAATTTGGGGAGG - Intronic
1021491191 7:21221218-21221240 TGTCAGCAGGGAGTTTGTGGAGG - Intergenic
1021984297 7:26084185-26084207 TGTCAGCCCAGCATTTTGGGAGG - Intergenic
1022284521 7:28942410-28942432 TCTCAGTCATGATTTTGTGGGGG + Intergenic
1023563254 7:41497610-41497632 TTTCAACCATGAATTTGGGGAGG - Intergenic
1023953027 7:44862557-44862579 TGTCAACAAAAAATTTGTGCAGG + Intergenic
1026030629 7:66790077-66790099 GATCAGCCAAAAATTGGTGGAGG + Intronic
1027712100 7:81617242-81617264 GGTCATGCAAGAATTTTTGGGGG - Intergenic
1027721303 7:81745001-81745023 TTTCAGGCAAGAATTTGTGCCGG + Exonic
1027861778 7:83593072-83593094 TGTAATCCAAGCATTTTTGGAGG - Intronic
1028315406 7:89395802-89395824 TGTCAGCAAAGAATTTATAAAGG + Intergenic
1028472492 7:91220271-91220293 TGTCAGCAAAGGCTTCGTGGAGG - Intergenic
1029546961 7:101215756-101215778 TGTCATCCAAGACTTTTGGGAGG - Intronic
1030305021 7:108008940-108008962 TGTCAGCCTGGAACTGGTGGAGG + Intergenic
1030903278 7:115150493-115150515 TAGAAACCAAGAATTTGTGGTGG - Intergenic
1031426600 7:121613095-121613117 TTTCAGCCAAGATTTTGTGTGGG + Intergenic
1032260127 7:130329027-130329049 TGTAAGCCCAGCATTTGGGGAGG + Intergenic
1033385777 7:140873714-140873736 AGTCAGTCAAGGATGTGTGGAGG - Intronic
1034933826 7:155185377-155185399 CTTCAGGAAAGAATTTGTGGAGG - Intergenic
1038832494 8:31077184-31077206 TGCCACCCTAGAATTTGTGTTGG + Intronic
1039049132 8:33477037-33477059 TGGCAGCCAAGATTGAGTGGGGG + Intronic
1041408741 8:57530326-57530348 TGTAATCCAAGCATTTGGGGAGG - Intergenic
1041523745 8:58783156-58783178 TTTCAGGCAAGTATTTCTGGTGG - Intergenic
1043315985 8:78922739-78922761 TGTCAGCAAACAATTTCTGGAGG + Intergenic
1046451743 8:114401448-114401470 TTTAAGCCCAGAATTTTTGGGGG - Intergenic
1047238655 8:123065097-123065119 TGTAATCCAAGAACTTTTGGAGG - Intronic
1047250241 8:123176606-123176628 TGTAATCCCAGAATTTGAGGAGG - Intergenic
1049573832 8:143381588-143381610 TCTCAGCCAAGAACCGGTGGCGG + Exonic
1055694962 9:78873675-78873697 TGTCATCCCAGCATTTGGGGAGG + Intergenic
1055805259 9:80085865-80085887 TGGCAGGCAAGAACTTGTGTAGG - Intergenic
1056232342 9:84559386-84559408 TGTCCTCCTAGAATTTGTGGTGG + Intergenic
1056930524 9:90872461-90872483 TTTCAGCCTAGAATTGGTTGCGG + Intronic
1057309209 9:93931301-93931323 TCTCAGCCAATAAAATGTGGCGG - Intergenic
1060146041 9:121253208-121253230 TGTCAGCCTACAAATTTTGGTGG + Intronic
1060705655 9:125797003-125797025 TTTCAACCAAGAATTATTGGGGG - Intronic
1061417993 9:130458415-130458437 TGTCAGCAGGGAGTTTGTGGAGG + Exonic
1062638310 9:137503123-137503145 TGTAATCCCAGAATTTTTGGAGG + Intronic
1185838460 X:3367337-3367359 TGTCAGCAGGGACTTTGTGGAGG + Intergenic
1185866989 X:3632959-3632981 TGTCATCCCAGCATTTGGGGAGG + Intronic
1187422860 X:19151361-19151383 AGTTACTCAAGAATTTGTGGAGG - Intergenic
1188149831 X:26658601-26658623 TGTAATCCAAGAATTTTGGGAGG - Intergenic
1189839094 X:45052949-45052971 TGTAATCCTAGAATTTGGGGAGG - Intronic
1190141537 X:47850117-47850139 CATCAGCCAAGGATTTCTGGTGG - Intronic
1190223055 X:48524949-48524971 TGTCATCCCAGAATTTTGGGAGG - Intronic
1190274166 X:48889825-48889847 TGTAATCCCAGAACTTGTGGAGG - Intergenic
1190495356 X:51023438-51023460 TGGCAACCCAGAATTTGTGAGGG + Intergenic
1190510627 X:51170492-51170514 TGGCAACCCAAAATTTGTGGGGG - Intergenic
1190934337 X:54982372-54982394 TGTCTGCCAATATTTTGTTGAGG - Intronic
1192285890 X:69735862-69735884 TGTGAGCAAAGAGTGTGTGGGGG - Intronic
1192423040 X:71051004-71051026 TGTAATCCCAGAATTTGGGGAGG + Intergenic
1194019202 X:88666206-88666228 TGCCAGCCAAGGAGTTATGGTGG - Intergenic
1196661552 X:118276233-118276255 TGTAATCCCAGAATTTGGGGAGG - Intergenic
1197545559 X:127819630-127819652 TGTTAGCCAATATTTTGTTGAGG - Intergenic
1198059571 X:133031888-133031910 TGTAATCCCAGAATTTGGGGAGG + Intronic
1198415376 X:136414452-136414474 TCTCAGCCAAGAATGAGTCGAGG - Intronic
1199689317 X:150296239-150296261 TGTCAGCAAAGAAATTTTAGGGG - Intergenic
1200208659 X:154335569-154335591 TGTAATCCCAGAATTTTTGGAGG - Intergenic
1200797008 Y:7349972-7349994 TGTCATCCCAGCATTTGGGGAGG - Intergenic