ID: 1088344230

View in Genome Browser
Species Human (GRCh38)
Location 11:108804757-108804779
Sequence CCGAAGCCTTCACTTTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088344230 Original CRISPR CCGAAGCCTTCACTTTTTGC TGG Intronic
908677018 1:66616052-66616074 ATGAAGCCTTCTCTTTGTGCAGG - Intronic
912919011 1:113847559-113847581 GTTAAGCCTTCTCTTTTTGCTGG + Intronic
913017201 1:114750899-114750921 CAGAAGACTTCACTTGATGCTGG - Intronic
920095148 1:203481917-203481939 CCGAAGCATTCATTTGTTGAGGG - Intronic
923043371 1:230336284-230336306 CCCTGGACTTCACTTTTTGCTGG - Intronic
1065859078 10:29855857-29855879 CTGAAGCCTCCACCTTTTGCTGG + Intergenic
1073511377 10:104044769-104044791 CAGAAACCTTCCCTTTTTGAGGG - Intronic
1074288437 10:112120187-112120209 GAGCAGCCTTCACTTTCTGCTGG + Intergenic
1075073515 10:119334942-119334964 CCAAAGCCTTAACTGTTTCCAGG + Intronic
1087985222 11:104670396-104670418 CGGAAGCATTCAAATTTTGCCGG + Intergenic
1088344230 11:108804757-108804779 CCGAAGCCTTCACTTTTTGCTGG + Intronic
1098077802 12:66751571-66751593 ATGAAGCCTTCTCTTTCTGCTGG + Intronic
1104817927 12:131659371-131659393 CAGAAACCTTCACTGGTTGCTGG - Intergenic
1112792036 13:103013913-103013935 CTGAGGCCTTCGATTTTTGCAGG - Intergenic
1117958541 14:61141420-61141442 CAGAAACCTGCACTTTTAGCAGG - Intergenic
1122281613 14:100626201-100626223 CAGAAGTCTTAACTTTTTCCAGG + Intergenic
1122436870 14:101706498-101706520 CCCAGCCCTTCCCTTTTTGCCGG - Intergenic
1129467493 15:75732110-75732132 CCGGAGCCTTCAATTTTTCCTGG + Intergenic
1129719711 15:77871459-77871481 CCGGAGCCTTCATTTTTTCCTGG - Intergenic
1132139927 15:99383877-99383899 CAGAAGCCTTGACTCATTGCAGG - Intronic
1134465722 16:14475486-14475508 CCCAAGCCCTCTCTTTTTTCCGG + Intronic
1139056516 16:63192171-63192193 ATGACGCTTTCACTTTTTGCAGG + Intergenic
1139427401 16:66891315-66891337 CAAAAGCCTTCACTTCTTTCAGG - Intronic
1141950543 16:87336467-87336489 CCGGAACCTTCACTTTTTGTTGG - Intronic
1157287306 18:46385727-46385749 TCCAAGCCTGCACTTTTGGCAGG + Intronic
1157680944 18:49605609-49605631 CCTTAGCCTTCACTTCCTGCTGG - Intergenic
1160837290 19:1130934-1130956 TCGAAGCCTTCACTTCTAGCAGG + Intronic
1162242207 19:9364266-9364288 CCGAGGCCTTGACTTACTGCTGG - Intronic
925201593 2:1971427-1971449 CCAAAGCCTTCTCTTTTGGGTGG - Intronic
926107663 2:10162585-10162607 TCAAAGCCCTCACTTTTTTCTGG + Intronic
928729419 2:34213841-34213863 TAGAAGCCTTCGCTTTTTTCTGG - Intergenic
930610214 2:53533976-53533998 CCCAAGCCATAACTTTCTGCTGG + Intronic
944896948 2:204174816-204174838 CCTCAGCCTTCCCTGTTTGCAGG + Intergenic
1170174644 20:13454942-13454964 CAGAAGTCTTCACTTTGTGGTGG + Intronic
1170406273 20:16041227-16041249 CTGGAGCCTTCACTTTTCCCAGG - Exonic
1178623244 21:34194412-34194434 AGGCAGCCGTCACTTTTTGCAGG + Intergenic
1184295605 22:43522404-43522426 CATCAGCCTTCACTTTCTGCTGG + Intergenic
949446631 3:4141843-4141865 CCCAAACCTTCATTTTGTGCTGG - Intronic
949470675 3:4393005-4393027 CCCTGGCTTTCACTTTTTGCTGG + Intronic
953050528 3:39338173-39338195 CAGAAGCCTACACTTTTTTGAGG - Intergenic
956153346 3:66267069-66267091 CTGAAGCATTCACTTTCTGGCGG + Intronic
959241460 3:103801136-103801158 TGTAAGCCTTCTCTTTTTGCTGG + Intergenic
959922619 3:111885167-111885189 CCGAGTCATTCACTTCTTGCTGG + Exonic
961598192 3:128036245-128036267 CCTTAGCCTTCACTTTCTGCTGG - Intergenic
962399357 3:135043937-135043959 CTGAAGACTCCACTCTTTGCAGG + Intronic
967380037 3:188847458-188847480 CCAAAGCCTTCTCTTCTTTCTGG - Intronic
969145983 4:5124453-5124475 CCCAAGCCCTCACTTTCTGGTGG - Intronic
970459741 4:16261632-16261654 CAGAAGCCTTCAGTTTCTGATGG - Intergenic
970756023 4:19428185-19428207 CCTTAGCCTTCACTTCTTGGTGG - Intergenic
980088576 4:128417331-128417353 CCCAAGCCTTCACTTTCACCAGG - Intergenic
983550032 4:169008724-169008746 CCCAAGCCATCAGTGTTTGCTGG - Intronic
984190168 4:176595968-176595990 CCAAAGCCTTAAGTTTTTGGAGG - Intergenic
985079435 4:186248790-186248812 CTGAAGCCCTCAATTGTTGCTGG - Intronic
987523580 5:19019409-19019431 CCTTAGCATTCACTTCTTGCTGG + Intergenic
987783320 5:22466608-22466630 CCGCAGCCTCCTCTTTTTTCTGG - Intronic
996360958 5:122645713-122645735 CCGAAGCTTTGACCTTTTCCTGG + Intergenic
999734124 5:154499884-154499906 CCCCAGCTTGCACTTTTTGCAGG + Intergenic
1001085478 5:168697225-168697247 CCGAAGGCCTCACTCTTGGCAGG - Intronic
1003334751 6:5159923-5159945 TTGAAGCCATCACTTTTTCCTGG + Intronic
1007753036 6:44081533-44081555 CTGCAGGCTTCAGTTTTTGCCGG - Intergenic
1016437627 6:144053662-144053684 CCGAAGCCTAAACTTTTAGGTGG - Intronic
1022222324 7:28325498-28325520 CCGAAGGCTTCCCTTGATGCTGG + Intronic
1027291227 7:76713144-76713166 AGGGAGCCTTCACTTTGTGCTGG - Intergenic
1030883821 7:114914935-114914957 AGGAAACCTTCACTTTTTCCCGG + Intergenic
1038554535 8:28498207-28498229 GCATAGCATTCACTTTTTGCAGG + Intronic
1040382497 8:46886488-46886510 TCACAGTCTTCACTTTTTGCTGG + Intergenic
1040547583 8:48410925-48410947 CCTCAGCCTTCATTTTGTGCTGG - Intergenic
1042293188 8:67191215-67191237 CCAAAGCCTCTACTTTTTACTGG - Intronic
1044004969 8:86928577-86928599 CCTGAGCCTTCTCTGTTTGCAGG + Intronic
1044502589 8:92975316-92975338 CCAAAGCCTAGACTTTTTGTGGG + Intronic
1044998152 8:97856705-97856727 CCTTAGCCTGCACTTTCTGCTGG - Intergenic
1050219272 9:3367756-3367778 CCAAAGCCTTAACATTTAGCAGG - Intronic
1055434344 9:76277273-76277295 CTGAAGCCTTCATTCTTTGGGGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1060829916 9:126706710-126706732 CCCAAGGCTTCACTTTATGTAGG + Intergenic
1185712624 X:2316258-2316280 CCGCAGCCGGCCCTTTTTGCTGG - Intronic
1187408852 X:19029517-19029539 TAGAAACCTTCACTTCTTGCAGG - Intronic
1199264083 X:145810057-145810079 ACCAAGCATGCACTTTTTGCAGG + Intergenic
1199530694 X:148844251-148844273 CCCAAGACCTCACTATTTGCAGG + Intronic