ID: 1088349158

View in Genome Browser
Species Human (GRCh38)
Location 11:108865270-108865292
Sequence ATAGTTAAGATATTTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 418}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088349158_1088349161 13 Left 1088349158 11:108865270-108865292 CCTTGAGCAAATATCTTAACTAT 0: 1
1: 0
2: 4
3: 51
4: 418
Right 1088349161 11:108865306-108865328 TCCAGGACTATATATCCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 89
1088349158_1088349160 12 Left 1088349158 11:108865270-108865292 CCTTGAGCAAATATCTTAACTAT 0: 1
1: 0
2: 4
3: 51
4: 418
Right 1088349160 11:108865305-108865327 GTCCAGGACTATATATCCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 77
1088349158_1088349159 -4 Left 1088349158 11:108865270-108865292 CCTTGAGCAAATATCTTAACTAT 0: 1
1: 0
2: 4
3: 51
4: 418
Right 1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG 0: 1
1: 0
2: 1
3: 6
4: 93
1088349158_1088349163 14 Left 1088349158 11:108865270-108865292 CCTTGAGCAAATATCTTAACTAT 0: 1
1: 0
2: 4
3: 51
4: 418
Right 1088349163 11:108865307-108865329 CCAGGACTATATATCCTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088349158 Original CRISPR ATAGTTAAGATATTTGCTCA AGG (reversed) Intronic
900851987 1:5151164-5151186 AGGGTTAAGTAATTTGCTCAAGG + Intergenic
901386853 1:8915743-8915765 ATAATAAAGAAAATTGCTCAAGG + Intergenic
902691806 1:18114601-18114623 AGAGTTAAGATATCTAGTCAGGG - Intronic
903276130 1:22223089-22223111 AGAGATACCATATTTGCTCAAGG - Intergenic
903620170 1:24692400-24692422 ATAGTTAAGATGTTGGCTAGGGG + Intergenic
906333767 1:44910283-44910305 AAAATAAAGTTATTTGCTCAAGG + Intronic
907126145 1:52052895-52052917 AGAGTTAAGAAACTTGCCCAAGG + Intronic
907407026 1:54259914-54259936 TTAATTAAGAAAATTGCTCATGG - Intronic
907770337 1:57455658-57455680 ACAGTGAAGCTATTTGCCCAAGG + Intronic
907791684 1:57672109-57672131 AAAGTTAAGTAAATTGCTCATGG + Intronic
907897923 1:58710188-58710210 ATAGTTAAGCAATTTACCCAAGG + Intergenic
908025887 1:59951141-59951163 ATGGTTAAGTTACTTGCCCAAGG + Intergenic
908223741 1:62035443-62035465 ATAGTTAAGCTACTTACTTAAGG + Intronic
908513214 1:64866455-64866477 GAAGTTAAGAAATTTGCCCAAGG - Intronic
908640825 1:66221374-66221396 ATAGGAAAGACAATTGCTCAAGG + Intronic
908680094 1:66650960-66650982 AGAGTTAAGCAATTTGCTCAGGG - Intronic
908901552 1:68962224-68962246 AAAATTAAGATACTTGCTCAAGG + Intergenic
909395366 1:75165817-75165839 GTATATAAGATATTTGCTAAAGG - Intergenic
909753023 1:79188127-79188149 TAAGTTAAGCTGTTTGCTCAAGG + Intergenic
909784804 1:79597794-79597816 ATAGTTAAGTTTTTTCTTCATGG - Intergenic
910336660 1:86140219-86140241 GTATTTAAGAAACTTGCTCAAGG + Intronic
910574219 1:88740628-88740650 AAAGTTAAGTAACTTGCTCAAGG + Intronic
911173274 1:94793487-94793509 CTAGTTAAGAATCTTGCTCAAGG - Intergenic
911199016 1:95025602-95025624 CTAGTTAAGATAATTGATTAAGG - Intronic
911544261 1:99197696-99197718 AGAGTTAACATATGTGTTCATGG - Intergenic
911587984 1:99713224-99713246 ATAGTTAAATAACTTGCTCAAGG + Intronic
911820204 1:102409448-102409470 ATAGCTAAGATAATTGATGAAGG + Intergenic
912422426 1:109552926-109552948 ATGGTTAAGTTACTTGCTCTGGG - Intronic
913684862 1:121222177-121222199 GAAATTAAGATATGTGCTCATGG + Intronic
914810634 1:151025112-151025134 AAGGTTAAGAGATTTGCTCAAGG - Intronic
915563627 1:156701773-156701795 GTGGTTAAGCCATTTGCTCAGGG - Intronic
915826527 1:159084105-159084127 GAAGTTAAGTCATTTGCTCAAGG + Intronic
916418776 1:164616916-164616938 TAAGTTAAGTAATTTGCTCAAGG + Intronic
916458424 1:164995297-164995319 AGAATTAAGCAATTTGCTCAAGG + Intergenic
917229460 1:172820325-172820347 AGAGATAAGTAATTTGCTCAAGG - Intergenic
917476827 1:175375959-175375981 AAATTTAAGAAATTTGCTCAAGG + Intronic
917617281 1:176758967-176758989 ATGGTTAAGAGACTTGCCCAAGG + Intronic
917773111 1:178302006-178302028 AAATTTAGGACATTTGCTCATGG - Intronic
918773580 1:188597846-188597868 ATAGTTAAGAGAGTTGACCAAGG - Intergenic
919166227 1:193897265-193897287 ATAGTTAATATATTTGGATAGGG + Intergenic
920290047 1:204915341-204915363 ATATCTAAGATATTTGTTAATGG + Intronic
921417284 1:214904297-214904319 ATTTTTAAGAGCTTTGCTCAAGG - Intergenic
921544452 1:216457695-216457717 AAAGTTCAGTAATTTGCTCAAGG - Intergenic
922903087 1:229153281-229153303 CTAGCTAAGATATTTGATGAAGG - Intergenic
923122928 1:231010303-231010325 ACAGTTAAGGGATTTTCTCAAGG + Intergenic
924327747 1:242912452-242912474 ATATCTAAGATAGTTGTTCAAGG - Intergenic
1063366126 10:5492026-5492048 GAAGTCAAGGTATTTGCTCAAGG + Intergenic
1063502210 10:6565268-6565290 ATACTATAGATATTTTCTCATGG - Intronic
1064192109 10:13215933-13215955 ATATTTAACAAATTTGCTTATGG - Intergenic
1064751904 10:18538661-18538683 ACAGTTAAGAAATTTGCCCCAGG - Intronic
1065051850 10:21801030-21801052 GCTGTTAAGATATTTGTTCAAGG - Intronic
1065073811 10:22055749-22055771 ATATTTAAGATAACTGCTTAGGG - Intergenic
1065179680 10:23112397-23112419 AAGGTTAAGAAATTTGCTCAAGG - Intronic
1065415829 10:25484710-25484732 ATAGTTAATGTCTTTGCTCATGG + Intronic
1068498431 10:57815054-57815076 ATATTTAAGATATTGGGTAAAGG - Intergenic
1069389769 10:67921258-67921280 CTTGTTAAAATATTTGTTCATGG + Intergenic
1070531984 10:77345025-77345047 ATAATTAAGTAACTTGCTCAAGG + Intronic
1070919887 10:80177979-80178001 AAAATTAAGAAATCTGCTCATGG + Intronic
1071325518 10:84512472-84512494 ATAGTTAAAATATATGGGCAGGG - Intronic
1072094741 10:92166915-92166937 TTAGTTAAGATAGTTGGTGAAGG - Intronic
1072892537 10:99336986-99337008 ACAGTTAAGTAATTTGCCCAGGG - Intronic
1072973535 10:100038125-100038147 GAAGGTAAGTTATTTGCTCAAGG + Intergenic
1073011609 10:100364324-100364346 ATAGTTAAGTGACTTGCCCAGGG - Exonic
1074240366 10:111632704-111632726 GTAGTTAAGTAATTTGCCCAAGG - Intergenic
1074747179 10:116546517-116546539 AGAGTTAAGAATTTTGCTCAGGG - Intronic
1078157136 11:8808813-8808835 TTAGTTAAGATACTTGCCCGTGG + Intronic
1078929095 11:15899660-15899682 AAGGTTAAGAGACTTGCTCAAGG - Intergenic
1079773505 11:24494926-24494948 GTAGTTAAGTAACTTGCTCAAGG - Intergenic
1079810049 11:24986991-24987013 AAAGTTAAGTAATTTGATCAAGG - Intronic
1079870059 11:25786205-25786227 ATAGTAGAGTTATCTGCTCAAGG + Intergenic
1079991601 11:27252450-27252472 ACAGTTAAGTAACTTGCTCAAGG + Intergenic
1079994470 11:27281290-27281312 AAAGTGAAGACATTTGCCCAAGG + Intergenic
1080042962 11:27778554-27778576 ATAGTTTAAATATTTGTTCTTGG - Intergenic
1081946462 11:46999148-46999170 ATATTTCAGAAATTTGCCCAGGG - Intronic
1081981042 11:47267468-47267490 GGGGTTAAGACATTTGCTCAAGG + Intronic
1082268757 11:50146769-50146791 ACAGTTAAGTAACTTGCTCAAGG + Intergenic
1082287367 11:50332297-50332319 ACAGTTAAGTAATTTGCTCAAGG - Intergenic
1082784735 11:57310684-57310706 GTGGTTAAGTGATTTGCTCAAGG - Intronic
1082857882 11:57825441-57825463 ATGCTTTAGAAATTTGCTCAAGG - Intergenic
1083041791 11:59695191-59695213 ATAGTAAAGGGATTTGCCCAAGG - Intergenic
1083134739 11:60661681-60661703 AGAGTAAAGTAATTTGCTCAGGG - Intergenic
1083237060 11:61357794-61357816 AATGTTAAGTGATTTGCTCAAGG - Exonic
1085144020 11:74176368-74176390 AAAGTGAAGTGATTTGCTCAAGG + Intronic
1085164691 11:74387519-74387541 ATACTTAAGAAATCTGTTCATGG + Intronic
1085636594 11:78163977-78163999 ACAGTGAAGTGATTTGCTCAGGG + Intergenic
1085751639 11:79167518-79167540 AAAGTTAAGAAAATTGCCCAAGG + Intronic
1086210240 11:84309490-84309512 AAAGTTAAGAGAATTGCTCAGGG - Intronic
1086377280 11:86214226-86214248 AAGGTTAAGAAATTTGCCCATGG - Intergenic
1086842796 11:91708297-91708319 ATAATTAAGATAAGTGCTGAGGG - Intergenic
1087050707 11:93883802-93883824 GTAGTTAAGGTGTTGGCTCACGG + Intergenic
1088263296 11:107965606-107965628 ATAGTAAAAATATTTGCTCCAGG + Intergenic
1088349158 11:108865270-108865292 ATAGTTAAGATATTTGCTCAAGG - Intronic
1088974578 11:114804271-114804293 AAGGTTAAGAGATTTGCTCTGGG + Intergenic
1090032646 11:123220279-123220301 AAAGTTAAGGCATTTGCCCAAGG - Intergenic
1090191790 11:124776214-124776236 ATAGTTAACATATTGGCTTATGG - Intronic
1090623345 11:128582258-128582280 GAGGTTAAGAAATTTGCTCATGG - Intronic
1091696148 12:2629588-2629610 GAAGTTAAGTTATTTGTTCAAGG + Intronic
1093947258 12:25123801-25123823 ATAGTTAAATGACTTGCTCAAGG - Intronic
1094629359 12:32157919-32157941 AAAGTTAAGTAATTTGCCCAGGG - Intronic
1097947066 12:65380771-65380793 GAAGTTTAGATATTTGCCCAAGG + Intronic
1100549257 12:95631539-95631561 ATAGTTGAGAAATCTGCACATGG + Intergenic
1100871193 12:98912182-98912204 GTTGTTAAGAAATTTACTCAGGG + Intronic
1100983224 12:100180249-100180271 ATAGTTAATATAAATGATCAGGG - Intergenic
1101191679 12:102340307-102340329 AAAGTTTAGAGACTTGCTCAAGG - Intergenic
1101385217 12:104251289-104251311 ACAGTCAAGATATGTTCTCAGGG - Intronic
1101690712 12:107077754-107077776 AGAGGTAAGAAATTAGCTCAAGG - Intronic
1101794309 12:107958723-107958745 GAAGTTAAGACATTTGCTCAAGG + Intergenic
1102149271 12:110677577-110677599 ACAGAGAAGAGATTTGCTCAGGG - Intronic
1102434159 12:112907629-112907651 GTAGTTAAGTGACTTGCTCAAGG - Intronic
1102787348 12:115615464-115615486 GTAATTAAGATATGTGCTCCAGG - Intergenic
1103216654 12:119206972-119206994 GAAGTTAAGAAATCTGCTCAGGG - Intronic
1103586074 12:121956874-121956896 AGAGTTAAGAAATTTGCTCAGGG - Intronic
1106059600 13:26275615-26275637 ATAGTTAAAAAATATGCACAGGG - Intronic
1107183756 13:37493355-37493377 ATAGTTAAGATCATGGCTCAGGG + Intergenic
1107696528 13:43005716-43005738 AGAGTTGAGTAATTTGCTCAAGG - Intergenic
1109093539 13:58080773-58080795 ACAGTGAAGATATTAGTTCAAGG + Intergenic
1109384121 13:61605346-61605368 ATCGTTAAGATATTTTATTAAGG - Intergenic
1109869654 13:68317380-68317402 TTAGTTAAGATAATTGATGAAGG - Intergenic
1109965092 13:69682012-69682034 ATAGCCAAGATATTTTCACAAGG + Intergenic
1110509019 13:76326945-76326967 AGAGTTAAAGTATTTGCTCAAGG + Intergenic
1111893259 13:94109094-94109116 ATAGTTAAGCAATTTTCCCAAGG - Intronic
1112629135 13:101141195-101141217 CCAACTAAGATATTTGCTCAGGG - Intronic
1113279596 13:108774413-108774435 TTAGACAAGAAATTTGCTCAGGG + Intronic
1114908555 14:27162976-27162998 ATATTTAAAATCTTTGCACATGG + Intergenic
1115058918 14:29167654-29167676 ATAGTTATGGTATTTGTTAAAGG + Intergenic
1115901594 14:38157000-38157022 TTAGTTAAGTTCTTTGCTCCGGG - Intergenic
1116361009 14:43997979-43998001 ATCGTGATGATATTTGCTAAAGG + Intergenic
1116510300 14:45736851-45736873 ATAATTAAGACATTTGGTGATGG - Intergenic
1116631045 14:47333952-47333974 ATGGTTCAGATATTTCCTCTAGG + Intronic
1116836728 14:49775921-49775943 ATAATTAAGACATTTGCTGCCGG - Intronic
1117151369 14:52891719-52891741 TTAATTTAGATATTTGCTGAGGG + Intronic
1117406371 14:55408150-55408172 GAAGTTAAGAAACTTGCTCAGGG + Intronic
1118062864 14:62160062-62160084 ATAGGGAAAATATTGGCTCAAGG + Intergenic
1119708704 14:76805236-76805258 AAAGTTAAGTAATTTGCTCAAGG + Intronic
1119783196 14:77292445-77292467 GAAGTTAAGTAATTTGCTCAAGG + Intronic
1119954667 14:78784200-78784222 ATAGTTAAGCTATTTGGGCTAGG + Intronic
1119973235 14:78996324-78996346 AAAGTCAAGTGATTTGCTCAAGG + Intronic
1119975131 14:79016727-79016749 AAGGTTAAAACATTTGCTCAGGG - Intronic
1120010683 14:79410606-79410628 GAAGTTAAGTAATTTGCTCAAGG - Intronic
1120318607 14:82929982-82930004 CTAGATAAGATATTTGATGAAGG - Intergenic
1120435677 14:84479100-84479122 AAAGTTAAAATATTTCCTCTTGG + Intergenic
1121869327 14:97392803-97392825 ATATTTCAGATATTTGTTTAAGG + Intergenic
1124268221 15:28256479-28256501 ATAGTTGAGGTATTTGCTAGAGG + Intronic
1124502288 15:30239502-30239524 ATAGTAAGTATATTTTCTCATGG + Intergenic
1124741275 15:32299149-32299171 ATAGTAAGTATATTTTCTCATGG - Intergenic
1125000455 15:34764768-34764790 CTAGTTAAGATCTTTGATGAAGG - Intergenic
1126152173 15:45533236-45533258 ATAGATAAGAGAATTGCCCAAGG + Intergenic
1126428363 15:48554015-48554037 AAAGTTAAGAAATTTGCCCAAGG + Intronic
1126971664 15:54120070-54120092 CTAGTTAAGATAATTGATGAAGG + Intronic
1127018788 15:54721508-54721530 GTAGTGTAGATATTTGCTCTAGG - Intergenic
1127200928 15:56649430-56649452 AGACTTAATATATTTGCTCCTGG - Intronic
1127530512 15:59839092-59839114 ATAGTGAAGACATTTGCTGGAGG + Intergenic
1127675344 15:61232744-61232766 ATAGTTAAAATATTTGGTTTGGG - Intergenic
1127705466 15:61542870-61542892 AGATTTAAAAAATTTGCTCAAGG - Intergenic
1127956354 15:63857188-63857210 AAAGTTAAGGAATTTGCCCAAGG + Intergenic
1128674944 15:69601733-69601755 ATAGTTAATTTGTTTGCTCAAGG + Intergenic
1128779712 15:70351366-70351388 AAGGTTAAGCAATTTGCTCAAGG + Intergenic
1129195332 15:73961539-73961561 TTATTTAAGATATTTGACCAGGG + Intergenic
1130786956 15:87109183-87109205 AAAGTAAATATATTTGGTCATGG + Intergenic
1133691816 16:8222860-8222882 ATGGTTAAGACATTTTGTCAGGG - Intergenic
1134302657 16:13005469-13005491 GAAGTTAAGTAATTTGCTCAAGG + Intronic
1135090927 16:19516321-19516343 AAAGTTAAATTATTTACTCAAGG - Intronic
1135614132 16:23895916-23895938 ATAATTAATATTTCTGCTCATGG + Intronic
1135650214 16:24199785-24199807 AAAGTTAAGGCATTTGCCCAAGG + Intronic
1137287669 16:47029877-47029899 ACAGTCAAGACAGTTGCTCAAGG - Intergenic
1138160944 16:54753802-54753824 ATTTTTAAGGTATTTGCTGATGG - Intergenic
1138302635 16:55945307-55945329 AAAGTTAAGCAATTTGCACAAGG + Intronic
1139785402 16:69388185-69388207 ACAGTTAAGGGATTTGTTCAAGG - Intronic
1140868072 16:79081572-79081594 AGAGTAAAGATTTTTGTTCAGGG - Intronic
1141144666 16:81520754-81520776 GAAGTTAAGTTATTTGCCCAAGG - Intronic
1141257751 16:82418603-82418625 AAGTTTAAGAAATTTGCTCAGGG + Intergenic
1141471551 16:84241966-84241988 GAGGTTAAGAAATTTGCTCAAGG - Intergenic
1142780265 17:2176080-2176102 AAAGTTAAGATATTTGCAAAAGG + Intronic
1143914930 17:10283882-10283904 ATAGAAAAGATATTTTCTGAAGG + Intergenic
1144368137 17:14564846-14564868 ATAGATAAAATAATAGCTCATGG + Intergenic
1145185349 17:20789115-20789137 ATAGTTAAGTGACTTGCCCAGGG - Intergenic
1146199311 17:30842433-30842455 CTAGTTAAACTATCTGCTCATGG + Intronic
1146522258 17:33535059-33535081 GTAGTTAAGCAACTTGCTCAAGG + Intronic
1146975821 17:37110806-37110828 TTAGTAAAGATAATTGCTCGAGG - Intronic
1149094402 17:52823625-52823647 ATATTTAAGAAATTTGCTTGGGG + Intergenic
1149486891 17:57049424-57049446 AAAGTTAAGTAATTTGCCCAGGG + Intergenic
1150120575 17:62598216-62598238 GTATTCAAGAAATTTGCTCAAGG - Intronic
1150179056 17:63095469-63095491 ATACTTAAGACTTCTGCTCAAGG - Intronic
1150861543 17:68806011-68806033 GTAGTGAAGATATTTGGGCAGGG - Intergenic
1151150924 17:72086165-72086187 ATAGCTTAGATATTTTCACAAGG + Intergenic
1151972998 17:77468620-77468642 GTGGTTAAGTTACTTGCTCAGGG + Intronic
1152156687 17:78638295-78638317 ACAGGTAAGTGATTTGCTCACGG - Intergenic
1153100784 18:1466962-1466984 ATATTTCAGCTATTTCCTCAGGG - Intergenic
1153434098 18:5049887-5049909 TTAACTAAGATATTTGTTCAAGG - Intergenic
1153680147 18:7492780-7492802 ATAGTGAAGATATTCTTTCAGGG - Intergenic
1157446727 18:47751787-47751809 GGAGTTAAGAAACTTGCTCATGG - Intergenic
1158965404 18:62618063-62618085 ATAGTGGAGATAGTTGCACAAGG + Intergenic
1162774032 19:12968133-12968155 ATGGTTAAGGGATTTACTCAAGG + Intronic
925731308 2:6921082-6921104 AAAGTTAAAATATTTTCTCTTGG - Intronic
926646509 2:15295435-15295457 ATAGTTAAGTAATTTGCACAAGG - Intronic
927090740 2:19709514-19709536 ATAGCAAAAATATATGCTCAAGG + Intergenic
927831430 2:26354220-26354242 AAATTTAAGTAATTTGCTCAGGG + Intronic
928424978 2:31170488-31170510 AAGGTTAAGCTATTTGATCAAGG + Intergenic
928796680 2:35031851-35031873 ATCGTTAAGATTTTTGCTAGTGG + Intergenic
929050887 2:37835792-37835814 ATAGTTAAGATTTTTTTTCTGGG - Intergenic
929724340 2:44408553-44408575 AGAGTTAAGTGAGTTGCTCAAGG + Intronic
929987279 2:46747068-46747090 GTAATTAAAATCTTTGCTCAAGG - Intronic
930172657 2:48267293-48267315 GGAATTTAGATATTTGCTCAAGG - Intergenic
930243868 2:48963525-48963547 ATAGTTGTGATATTGGCTCTTGG + Exonic
932041232 2:68302022-68302044 ATAATAAAGATAATTGTTCAGGG - Intronic
932075496 2:68659139-68659161 ATGGGGAAGATATTTGTTCATGG + Intergenic
932155230 2:69410503-69410525 ATGGTTGAGTAATTTGCTCAAGG - Intronic
932211066 2:69930950-69930972 AGAGTTAAGTAATTTGCCCAGGG + Intronic
932794397 2:74682091-74682113 ATAGTTAAGCTATATGGTTATGG - Intronic
933340424 2:81018240-81018262 AAAGTTAAGGTATTTACCCAGGG + Intergenic
933632908 2:84676785-84676807 ATGGTTAAGTAAGTTGCTCAAGG - Intronic
933911457 2:86944155-86944177 AGATTTAAGATACTTGTTCAGGG + Intronic
935991327 2:108721192-108721214 AGATTTAAGATACTTGTTCAGGG + Intronic
936427099 2:112431500-112431522 AGATTTAAGATACTTGTTCAGGG - Intronic
936758675 2:115746661-115746683 ATATTTAAGAAACTTGATCAGGG + Intronic
936796200 2:116207227-116207249 AAAGTTAAGAGATGTGCTCAAGG - Intergenic
937158790 2:119740770-119740792 CAAGTTAAGAAATTTGCTCAAGG + Intergenic
937576439 2:123428105-123428127 AGAGTTTAGATATTTGCCTAAGG + Intergenic
937675881 2:124589653-124589675 ATACGTAAGATATTAGCACAGGG - Intronic
938644033 2:133312999-133313021 ATGGTTAAGTAATTTGCTTAGGG + Intronic
939207610 2:139127883-139127905 ATAGATAAGATAATTGATGAAGG + Intergenic
939482570 2:142767869-142767891 ATAGAGATGATATATGCTCAAGG + Intergenic
939592650 2:144084298-144084320 ATAGTTAAACAATTTGCTTAAGG - Intronic
940202787 2:151169346-151169368 ATAGTTAAAATATTTAATGATGG + Intergenic
940792059 2:158039481-158039503 AAAGTTAAGCAACTTGCTCAAGG + Intronic
941501232 2:166279863-166279885 AGAGTTAAAATATTTGTCCAAGG + Intronic
941607867 2:167622435-167622457 ATTTTTAATATATTTCCTCAGGG - Intergenic
941827071 2:169911478-169911500 AAATTTAAGTAATTTGCTCAAGG + Intronic
942546652 2:177071624-177071646 AAAGTTAAAAGATTTGCTTAAGG + Intergenic
942886419 2:180930077-180930099 ATGGTGAAGACATTTGCTTAAGG - Intergenic
944499221 2:200341210-200341232 AAAGTTAAGTGATTTCCTCAAGG + Intronic
944654831 2:201867104-201867126 ATACTTAATATGTTTGTTCAGGG - Intronic
945942108 2:215960538-215960560 ATAATTAAGATATTTGGGCTGGG + Intronic
946161873 2:217840491-217840513 ACAGTTAAGAAACTTGCCCAAGG + Intronic
947106112 2:226669444-226669466 ATAGTCAAGGGATTTGCTGATGG + Intergenic
947224082 2:227823353-227823375 AGAGTTAAGAAACTTACTCAAGG + Intergenic
947265415 2:228274295-228274317 GAGGTTAAGATATTTGCACAAGG + Intergenic
947835410 2:233171450-233171472 TTAGTAAATATATTTGATCACGG - Intronic
948284760 2:236774852-236774874 GTAGATGAAATATTTGCTCATGG + Intergenic
1168984160 20:2033498-2033520 ATAGCTGGGCTATTTGCTCAGGG - Intergenic
1170087842 20:12555253-12555275 ATAGTTAACAAATCTACTCATGG - Intergenic
1170588841 20:17755813-17755835 ATAGAGAGGTTATTTGCTCAAGG + Intergenic
1170728347 20:18949150-18949172 AAAGTTAAGTGATTTGCCCAAGG - Intergenic
1172467546 20:35167227-35167249 ATAGTTAAGTAACTTGCCCAAGG - Intergenic
1172731152 20:37089244-37089266 GAAGTGAAGATATTTGCCCAAGG + Intronic
1173896647 20:46556050-46556072 ATAGTAAAGAGATCTGCTCAAGG + Intergenic
1173934430 20:46848746-46848768 AGAGATAAGATATTCACTCATGG + Intergenic
1174179416 20:48665559-48665581 ATAGTTAAGAAACTTTCTCAAGG - Intronic
1174586441 20:51612190-51612212 GTAGTAAAGTTATTTGCTCAAGG + Intronic
1175078810 20:56400534-56400556 ATAGCTTATATATTTGCTCTAGG + Intronic
1175238757 20:57530728-57530750 AAGGTTAAGAAACTTGCTCAAGG + Intergenic
1177384147 21:20387414-20387436 ATAATTAAGAAATATGCCCAAGG - Intergenic
1178517595 21:33262015-33262037 GAAGTTAAGAAACTTGCTCAAGG - Intronic
1179081093 21:38171384-38171406 AAAGTTAAGAAAGGTGCTCAGGG + Intronic
1179093179 21:38287177-38287199 ATTTTTAAGATATTAGCTCAGGG - Intronic
1179167873 21:38948694-38948716 AAAGTTAAGTAACTTGCTCAAGG + Intergenic
1181974421 22:26718692-26718714 GTGGTTAAGTGATTTGCTCAAGG - Intergenic
1182246902 22:28965426-28965448 CAAGTTCAGAAATTTGCTCAAGG + Intronic
1182743372 22:32585259-32585281 GAAGTTAAGAAATTTGCTGAAGG + Intronic
1182952748 22:34392906-34392928 ATAATTAAGAGACTTACTCAAGG + Intergenic
1184203746 22:42987193-42987215 ATAGTTAAAATATTTGTTCAGGG - Intronic
1184236119 22:43183908-43183930 ATAGTTAAGTAACTTGTTCAAGG - Intronic
949660730 3:6275516-6275538 ATAGTTATGACATTTGCATAAGG + Intergenic
949687813 3:6597958-6597980 ATAGCTAAAATAAATGCTCAGGG - Intergenic
950123022 3:10494398-10494420 GAAGTTAAGTCATTTGCTCAAGG + Intronic
950795211 3:15504988-15505010 AAAGTAAAGATAATTGTTCAGGG - Intronic
951007193 3:17631442-17631464 ATAGTTAAGATAACTGATGAAGG + Intronic
951274598 3:20670176-20670198 AAAGTTAAACTAATTGCTCAAGG - Intergenic
951612827 3:24510965-24510987 AAAATTAAGAAATTTGCCCAAGG + Intergenic
951822910 3:26833776-26833798 ATAGTTCAACTCTTTGCTCAAGG - Intergenic
951930184 3:27956424-27956446 TTAACTATGATATTTGCTCAAGG - Intergenic
951949584 3:28184887-28184909 ATGGTTAAGAAATTTGCCTAAGG - Intergenic
952121722 3:30253031-30253053 ATAGAGAAGAGATTTGCTTAAGG + Intergenic
953728139 3:45418835-45418857 GAAGTTAAGTAATTTGCTCAAGG - Intronic
955511971 3:59690275-59690297 GCAGTTAAGATAGTTGCCCAAGG - Intergenic
955713937 3:61808995-61809017 AAAGTTAAGTCATCTGCTCAAGG - Intronic
957686734 3:83512005-83512027 CTCTTTAATATATTTGCTCATGG - Intergenic
958783199 3:98567495-98567517 ATAATTAAAATATTTTCTGATGG + Intronic
958786493 3:98602382-98602404 ATAGTTAAGGGAATGGCTCATGG + Intergenic
959552100 3:107672993-107673015 AAAATTAAGAAATTTGCTCAAGG - Intronic
960109904 3:113835961-113835983 ATATTTAAGAAATATGCTCATGG + Intronic
960171460 3:114466436-114466458 AAAGTTCAGATATGTTCTCATGG - Intronic
960203419 3:114866094-114866116 GTGGTTAAGATCTTTGCCCAAGG - Intronic
960588268 3:119341495-119341517 GAGGTTAAGAAATTTGCTCAAGG + Intronic
960961930 3:123077201-123077223 GGAGTTAAGAAATTTGCTGAAGG - Intronic
961585176 3:127916009-127916031 AAAGTTAAGAGAGTTGCTCAGGG - Intronic
962654979 3:137533888-137533910 GTAGTAAAGATAGTTGATCAAGG - Intergenic
966096050 3:176204330-176204352 CTAGTTAAGATAATTGGTGAAGG + Intergenic
966122264 3:176536110-176536132 GTAGTTAGGTAATTTGCTCATGG - Intergenic
966634034 3:182112380-182112402 ATAGATAAGTAATTTTCTCAAGG + Intergenic
966858625 3:184214723-184214745 ATTGTTAACCTATTTCCTCAAGG + Intronic
967164469 3:186768145-186768167 ATAGTTCTAATATATGCTCATGG + Intergenic
967838796 3:193986891-193986913 AGAGTTAAGCAATTTGCTCAGGG - Intergenic
970500340 4:16670680-16670702 ATAGTTAAGTAATTTGCCCAAGG - Intronic
970630831 4:17942652-17942674 ATAACTATGATACTTGCTCAGGG + Intronic
971623014 4:28881470-28881492 AGAGTTGAGATAATTGCACAAGG - Intergenic
971731518 4:30388368-30388390 ATTCTTAAGATATATGCTAAAGG + Intergenic
972022962 4:34337948-34337970 CTAGTTAAGATAATTGATGAAGG + Intergenic
972719983 4:41686631-41686653 AAGGTTAAGTAATTTGCTCAAGG - Intronic
972804543 4:42514791-42514813 TAAGTTAAGTTACTTGCTCAGGG - Intronic
972876662 4:43370419-43370441 TTAGCCAAGATAATTGCTCATGG + Intergenic
973566848 4:52197585-52197607 GCAGTTAAGGAATTTGCTCATGG - Intergenic
973843834 4:54890823-54890845 ATAGTTAAGTAACTTGCCCAAGG - Intergenic
975224770 4:71858853-71858875 ATATTTAAGATGTTTGAACAGGG - Intergenic
975353657 4:73373715-73373737 ATATTTAAAATATTTGTTCTAGG - Intergenic
975474370 4:74806095-74806117 AAAGCTAAGTAATTTGCTCAAGG - Intergenic
976462734 4:85331101-85331123 TCAGTTAAGATAATTGCTAAAGG + Intergenic
976517928 4:85993009-85993031 GAAGTTAAACTATTTGCTCAGGG - Intronic
976901763 4:90186180-90186202 AGAGTTAAGAGACTTGCTCTAGG + Intronic
977377506 4:96224819-96224841 AAAGTTAAGAGATTTACTAAAGG - Intergenic
977385479 4:96333755-96333777 ATAGCTATGATATGAGCTCATGG + Intergenic
977521177 4:98086264-98086286 AAAGTTAAGTAATTTGCCCAAGG + Intronic
977531984 4:98211172-98211194 GAAGTTAAGATATTTGCTGGAGG - Intergenic
977612842 4:99054220-99054242 ATAGCTAAGATAATTGATGAAGG - Intronic
977831033 4:101593178-101593200 AAAGTTAAGTCACTTGCTCAAGG - Intronic
978103982 4:104878886-104878908 AAAGTTAAGTATTTTGCTCAAGG - Intergenic
979766013 4:124464575-124464597 AGAGTTAAGATATATACTGATGG - Intergenic
979780789 4:124649435-124649457 ATAGTTAATATTTTTCCTGAAGG + Intergenic
979804466 4:124953724-124953746 AGAGCTAGGAGATTTGCTCAGGG - Intergenic
980832072 4:138142940-138142962 ATAGAGAAGATATTTGCTTTTGG - Intergenic
981156720 4:141446095-141446117 AAAGTTAAGAAATATTCTCAAGG - Intergenic
981588470 4:146329607-146329629 ATTGTTAAGTTATTTCCTCAGGG + Intronic
981593334 4:146389801-146389823 CTAGTTAAGTGATTTGCCCAAGG - Intronic
981849071 4:149206700-149206722 GTAGTTAAATTATTTGCTCATGG - Intergenic
982961727 4:161847418-161847440 TTGGTTAAGTAATTTGCTCAAGG + Intronic
983284379 4:165720914-165720936 AAGGTTAAGTTATTTACTCAAGG - Intergenic
985088115 4:186335370-186335392 CTAGTTAAGATACTTGATTAAGG + Intergenic
985166683 4:187102907-187102929 ACAGTTAAGAAATTTACTCAGGG + Intergenic
985420531 4:189781077-189781099 ATATTTAAGAGATTTAATCATGG - Intergenic
987921849 5:24293787-24293809 ATATTTAAGATTTTTGGGCAGGG + Intergenic
988848325 5:35153013-35153035 ATACAAAAGTTATTTGCTCAAGG - Intronic
989091839 5:37742054-37742076 ATAAAAGAGATATTTGCTCATGG - Intronic
989416879 5:41188948-41188970 ATACTCAAATTATTTGCTCATGG - Intronic
989728075 5:44611474-44611496 CTAGTTGAAAGATTTGCTCATGG + Intergenic
990229378 5:53695110-53695132 AAAGTTAAAATAATTTCTCAAGG + Intergenic
990644201 5:57825381-57825403 ATAGTTAAGGAATTTGCTCTAGG + Intergenic
991388687 5:66118406-66118428 GTAGTTAAGATATCTTCTGACGG + Intergenic
991943244 5:71875454-71875476 GTGGTTAAGATTTTTGGTCAAGG + Intergenic
992216522 5:74529676-74529698 ATAGGTATGATAAATGCTCAAGG + Intergenic
992657607 5:78926038-78926060 ATAGTTCAAATATATTCTCAAGG - Intronic
993488408 5:88515290-88515312 ATGGTTAAGCAATTTGCCCAAGG + Intergenic
993771750 5:91936911-91936933 CTAGTTAAGATATTTAATGAAGG - Intergenic
993843929 5:92916052-92916074 GAATTTAAGACATTTGCTCAAGG + Intergenic
994176006 5:96712219-96712241 GCAGTTTAGAAATTTGCTCAAGG + Intronic
995140522 5:108730251-108730273 TTAGTTAAGTAATTTCCTCAAGG + Intergenic
995291507 5:110461527-110461549 ATAGCTAAGATAATTGATGAAGG + Intronic
995436541 5:112142742-112142764 AAAGTTAAGAAACTTACTCAAGG - Intronic
995708949 5:115015176-115015198 AAAGTTAAGCAATTTGTTCAAGG - Intergenic
996334907 5:122372729-122372751 ATAGTTTAGATATTTGCTCGTGG + Intronic
996500287 5:124209061-124209083 ATGTTTAAGACATTTGTTCAAGG - Intergenic
996790328 5:127286328-127286350 ATAGTAATGATAAATGCTCAAGG + Intergenic
997113887 5:131104761-131104783 ATGGTTAAGATATTTCCCCTTGG - Intergenic
997485746 5:134229066-134229088 ATTATAAAGCTATTTGCTCAAGG - Intergenic
998627544 5:143862676-143862698 AAAGTAAAAATATTTGCTTAAGG + Intergenic
998889028 5:146726677-146726699 GTTGTTAAGATATTGACTCAAGG - Intronic
998916329 5:147015672-147015694 AGAGTTAAGAAACATGCTCACGG - Intronic
999190072 5:149740675-149740697 GAAGTTAAGATACTTGCTCAAGG - Intronic
999631346 5:153574809-153574831 ATAGGGAAGAGATTTGTTCAAGG - Intronic
999672518 5:153970158-153970180 AAAGTTAAGAAACTTGCTGAAGG - Intergenic
999702441 5:154240245-154240267 GAAGTTAAGAGATTTGCCCAAGG - Intronic
999806349 5:155084974-155084996 AAGCTTAAGATATTTGCTCAAGG - Intergenic
999830671 5:155316187-155316209 AAAGTTAAGCAATTTGCTTAAGG + Intergenic
999874164 5:155783993-155784015 ATCTTTAAGATATTTGCTGAGGG + Intergenic
999935777 5:156484539-156484561 ATAATTAAGATACTAGCTTAGGG - Intronic
1000671582 5:164069641-164069663 GAAGTTAAGAAATTTGTTCATGG + Intergenic
1000750749 5:165093697-165093719 AAAGTCAAAATATTTGCTGAAGG - Intergenic
1001270664 5:170309244-170309266 GAGGTTAAGAAATTTGCTCAAGG - Intergenic
1002590123 5:180285349-180285371 AAAGTGAAGCTATTTGCACATGG + Intronic
1003743476 6:8970683-8970705 TTAGTTAAGATTATTGCTCAGGG - Intergenic
1003968735 6:11278395-11278417 AAGGTTAAGATACTTGCTCGAGG + Intronic
1003999203 6:11579288-11579310 GAAGTTAAGTGATTTGCTCAAGG - Exonic
1004059047 6:12172721-12172743 GTGGTTGAGATAATTGCTCAGGG + Intergenic
1004174241 6:13325261-13325283 ATAGTTAAGACATTTCTTCAGGG + Intronic
1004209919 6:13629380-13629402 CTAGTTAAGATACATGCACATGG + Intronic
1004802407 6:19164244-19164266 ATGCTTAAGATCTTTGCTCCTGG + Intergenic
1005235186 6:23753289-23753311 ATAGCTAGAAAATTTGCTCATGG - Intergenic
1006337874 6:33430294-33430316 ATAATTAACACATTTGCTCCTGG + Intronic
1006541725 6:34745542-34745564 ATAGATATGATCTTTGGTCAGGG - Intergenic
1007293503 6:40804210-40804232 ATATTTAAGACACTTGATCAGGG + Intergenic
1009515948 6:64618229-64618251 ATAGCTGAGATATTAGCTTATGG - Intronic
1009842683 6:69096455-69096477 ATAGTTAACATAATTGTTAATGG - Intronic
1010119632 6:72359840-72359862 ATTCTTTAGATATCTGCTCATGG - Intronic
1010657520 6:78529170-78529192 AAGGTTAAGAAACTTGCTCAAGG - Intergenic
1011530518 6:88315987-88316009 CTAATTAAGATTTTTGCACAAGG - Intergenic
1012595957 6:101039877-101039899 ATATTTAAGACTTTTGCTCTTGG - Intergenic
1012885217 6:104838664-104838686 TTACTCAAGAAATTTGCTCAAGG - Intronic
1013401132 6:109797321-109797343 GCAGTTAAGTCATTTGCTCAAGG - Intronic
1013727830 6:113121905-113121927 ATTGTTATAATCTTTGCTCATGG + Intergenic
1013819976 6:114143153-114143175 ACAGTTAAGTAATTTGCCCAAGG - Intronic
1014347928 6:120298946-120298968 ATAGTTAATATTTTGGCTTATGG + Intergenic
1014946614 6:127506058-127506080 AATTTTAAGTTATTTGCTCAAGG + Intronic
1017314111 6:153009811-153009833 ACAGTTAAAATATTTGCATAGGG + Exonic
1017956675 6:159184070-159184092 AGAGTTAAGTGATTTGCCCAAGG - Intronic
1018256807 6:161928748-161928770 GTAGTTAAGAAACTTGATCAAGG + Intronic
1020255835 7:6502840-6502862 ATCGTTGAGATAGTTGCCCATGG + Exonic
1020701607 7:11490806-11490828 ATAGTTAAATTATCTGCTCAAGG - Intronic
1021472490 7:21020929-21020951 AATGTTAAGATATTGACTCAGGG - Intergenic
1022063974 7:26831701-26831723 AAAGTTAAGAAATTTGCTGGAGG + Intronic
1022424536 7:30255875-30255897 ATTGTTAAGAAATCTGTTCAAGG + Intergenic
1022632489 7:32098328-32098350 AAAGTTAAGTGATTTGCCCAAGG + Intronic
1024439380 7:49398366-49398388 AAAGTTAAGCAATGTGCTCAGGG + Intergenic
1024850187 7:53704667-53704689 ATGGTTAAGTAACTTGCTCAAGG - Intergenic
1028722046 7:94044311-94044333 ATAAATAAGATCTTTGTTCAGGG - Intergenic
1030323598 7:108195711-108195733 ATACTTAAAATGTTTGCTAAAGG - Intronic
1030350792 7:108483781-108483803 ATAATTAAGCTATTTCCTAAAGG + Intronic
1030555673 7:111021188-111021210 ATAGGTTAGCTATTTCCTCATGG + Intronic
1030664676 7:112262964-112262986 AATGTTAAGATATTTGCTCAGGG + Intronic
1031206875 7:118770956-118770978 ATAATTACGATATTTGCTATGGG - Intergenic
1031799894 7:126229848-126229870 ATAGTTAAGATATTGGCAAAGGG + Intergenic
1033806335 7:144958573-144958595 AAATTTAAGAGACTTGCTCAAGG - Intergenic
1036010835 8:4720902-4720924 AAAGTTAAGATGTTTGATCAAGG - Intronic
1037468041 8:19179353-19179375 ATAGTTAATATGTTTGCTTTTGG - Intergenic
1037790440 8:21934854-21934876 ATAGTCAAGATGTTTACACAAGG - Intronic
1038948138 8:32384380-32384402 AGAGATAAGAGATTAGCTCATGG + Intronic
1038971400 8:32640110-32640132 ACAGCAAAGATATTTGCTCAAGG + Intronic
1039176912 8:34818699-34818721 ATAGTAAATATATTTCCTCTAGG + Intergenic
1039214500 8:35254423-35254445 ATAGTTCAGCCATTTGATCATGG - Intronic
1041661944 8:60409425-60409447 AGAGTGAAGCAATTTGCTCAAGG + Intergenic
1042223768 8:66498986-66499008 ATAGCTAAGCAACTTGCTCAAGG - Intronic
1042467937 8:69149570-69149592 AAAGTTGAGATATATGATCAAGG - Intergenic
1042628457 8:70787858-70787880 ATTATTAAGGTATTTGGTCAAGG + Intronic
1042691719 8:71507221-71507243 AAAGTTAAGACATTTGCCCAAGG + Intronic
1043091963 8:75915605-75915627 ATAGAAAAGATAATTACTCAAGG - Intergenic
1044864791 8:96560299-96560321 AAAGTTAAGAAATTTTCTCAAGG - Intronic
1045248531 8:100464042-100464064 GAAGTTAAGCCATTTGCTCAAGG - Intergenic
1046163345 8:110395917-110395939 ATAGTTTAGATGGTTGCTCAGGG + Intergenic
1047477814 8:125251783-125251805 AAAGTTAAATCATTTGCTCAAGG + Intronic
1047560445 8:125982089-125982111 CTAGTTAAGATAATTGATGAAGG + Intergenic
1047948781 8:129910290-129910312 ATAGCTAAGATAATTATTCAAGG - Intronic
1048921628 8:139236636-139236658 ATAGATAAGATTTTTGTTTATGG + Intergenic
1050662670 9:7900004-7900026 ACATTTATGCTATTTGCTCATGG + Intergenic
1052630371 9:31030104-31030126 ATATTTAAGTGTTTTGCTCAAGG - Intergenic
1052690729 9:31813576-31813598 CTAGTTAAGATCATTGCTAAAGG - Intergenic
1053387180 9:37702298-37702320 CAAGTGAAGATCTTTGCTCACGG - Intronic
1054916821 9:70502159-70502181 AGAATTAAAATATTTGCCCATGG + Intergenic
1055871924 9:80890638-80890660 ATACTTAAAATATTTTCTAAAGG + Intergenic
1056086257 9:83152239-83152261 ATAGTTAAACTATTTGATTAAGG - Intergenic
1056540981 9:87571278-87571300 ACAGTTCAGATACTTGCTCCAGG - Intronic
1057411136 9:94817370-94817392 AAAGTTAACATATTCCCTCATGG + Intronic
1058033672 9:100227024-100227046 GGAGTTAAGCAATTTGCTCAAGG - Intronic
1058360502 9:104141270-104141292 AAAGTTAGGAAACTTGCTCAGGG + Exonic
1058362086 9:104159996-104160018 TTAGTTAAGTAATTTGCCCAAGG + Intergenic
1058376280 9:104325616-104325638 ATATTTAAGGTATTTGCTGAAGG + Intergenic
1058399687 9:104600314-104600336 AAAGTTAAGTAATTTGCTTAAGG + Intergenic
1058400146 9:104606526-104606548 AAAGTTAAGTAATTTGCTTAAGG + Intergenic
1058440875 9:105005687-105005709 AGAGTTATGGAATTTGCTCAAGG + Intergenic
1058621444 9:106887574-106887596 ATATTTAAGGGACTTGCTCAAGG + Intronic
1058648695 9:107154830-107154852 AAGGTTGAGAGATTTGCTCAAGG - Intergenic
1059156581 9:111994526-111994548 TTAGTTAAGATAATTGATGAAGG - Intergenic
1186062951 X:5730469-5730491 TCAGTTAAGATGTTTGCTCTGGG - Intergenic
1186771481 X:12822259-12822281 ATAGTTAACATATTTGACCTTGG - Intronic
1187090505 X:16091248-16091270 GTAGTTAAGTAACTTGCTCAAGG + Intergenic
1187532491 X:20109607-20109629 AAGGTTAAGTTATTTGCCCAAGG - Intronic
1187938343 X:24357629-24357651 AGAGTTAAATAATTTGCTCAAGG + Intergenic
1188625883 X:32284672-32284694 AGATTTAAGAGACTTGCTCAAGG + Intronic
1190275173 X:48894593-48894615 ATAGTTAAAATGTTTACTGAGGG + Intronic
1190409943 X:50126622-50126644 ATAGTTAAGTTACTTGCCTATGG + Intergenic
1190435516 X:50420850-50420872 AGAGTTAAATGATTTGCTCAGGG + Intronic
1191844654 X:65537926-65537948 AAAGTTAAGTAACTTGCTCAAGG - Intergenic
1192860416 X:75063059-75063081 AAAGTTAAGTGATTTGCTCAAGG + Intronic
1193411876 X:81174621-81174643 ATATTTAAGCAATTTGCTCAAGG - Intronic
1193599455 X:83491735-83491757 AAAGGTAAGAGATGTGCTCAAGG - Intergenic
1194421649 X:93682136-93682158 AGAGTTAAGAAATGTGCCCAAGG - Intronic
1196065160 X:111456187-111456209 AAAGTTAAGAAATTTACCCAGGG - Intergenic
1196142019 X:112273764-112273786 AAGGTTAAGTTACTTGCTCAAGG - Intergenic
1196805381 X:119579454-119579476 ATAGCAAAAATAGTTGCTCATGG + Intronic
1196961565 X:121008712-121008734 ATAGTGAAATGATTTGCTCAAGG + Intergenic
1197390615 X:125859031-125859053 ATAGTTAAGTGACTTGCCCAAGG - Intergenic
1197392235 X:125882323-125882345 AAAGTTAAGTAATTTGCTCAAGG - Intergenic
1199146091 X:144368948-144368970 AAAGTTAAATAATTTGCTCAAGG + Intergenic
1199795060 X:151186632-151186654 ATAGTCAAAATATTTGTTCAGGG - Intergenic
1199841088 X:151649906-151649928 ATGTTTAAAATATGTGCTCATGG - Intronic
1199982811 X:152930096-152930118 ATGGTTAAGTAACTTGCTCAAGG + Intronic
1201588986 Y:15592968-15592990 AAGGTTAAGTAATTTGCTCAAGG - Intergenic