ID: 1088349159

View in Genome Browser
Species Human (GRCh38)
Location 11:108865289-108865311
Sequence CTATGCTGCTTGAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088349156_1088349159 25 Left 1088349156 11:108865241-108865263 CCTGGTGATAGCAGTAGATCACT 0: 1
1: 0
2: 2
3: 6
4: 100
Right 1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG 0: 1
1: 0
2: 1
3: 6
4: 93
1088349158_1088349159 -4 Left 1088349158 11:108865270-108865292 CCTTGAGCAAATATCTTAACTAT 0: 1
1: 0
2: 4
3: 51
4: 418
Right 1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG 0: 1
1: 0
2: 1
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088349159 Original CRISPR CTATGCTGCTTGAAGTGTCC AGG Intronic
909172624 1:72315570-72315592 CAATGGTGCTTGAGGTGTCAGGG - Intergenic
920999277 1:211026352-211026374 CTATACTCCTTGGAGTTTCCAGG - Intronic
922683072 1:227616992-227617014 CCATGGTGCTTGAGGTGTCATGG + Intronic
923152904 1:231250173-231250195 CAATCCTGCTTGAAGTGTGGAGG + Intronic
1064701211 10:18023657-18023679 TTATGCTGGTTGCAGTGTGCTGG + Intronic
1067394040 10:45895465-45895487 CTACACTTCTTTAAGTGTCCTGG + Intergenic
1067862364 10:49864598-49864620 CTACACTTCTTTAAGTGTCCTGG + Intronic
1068195361 10:53709111-53709133 GTATACTGCTTGAAGTGGCCAGG - Intergenic
1071159537 10:82729531-82729553 CTATGCACCCTGAAGTGTACAGG + Intronic
1075993722 10:126859725-126859747 TTATGCTGTTTGAAGTGACTAGG - Intergenic
1076246303 10:128950142-128950164 CTAAGGAGCTTGGAGTGTCCAGG - Intergenic
1076299688 10:129415574-129415596 CTATCCTGCTTCCAGTGACCAGG - Intergenic
1077112759 11:869170-869192 CCATGCTCCCTGATGTGTCCAGG + Exonic
1080686096 11:34516040-34516062 CTATCCTGCTTCTGGTGTCCTGG + Intergenic
1082130993 11:48489211-48489233 TTGTGCTGCTGGTAGTGTCCTGG + Exonic
1082245812 11:49920896-49920918 TTTTGCTGCTGGTAGTGTCCTGG - Intergenic
1082564494 11:54660085-54660107 TTTTGCTGCTGGTAGTGTCCTGG + Intergenic
1087465715 11:98502494-98502516 CCATGCTGCTTGGAGCATCCTGG + Intergenic
1087829565 11:102804305-102804327 CTATCCAGATGGAAGTGTCCTGG - Intergenic
1087878263 11:103384663-103384685 CTAAGCTTCTTGAACTGTCTGGG - Intronic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1090053437 11:123401301-123401323 CTATTCTGCTAGAAGCATCCCGG + Intergenic
1103005460 12:117416974-117416996 CTTTCCTCCTTGGAGTGTCCTGG + Intronic
1104509251 12:129361028-129361050 CTTTGCAGGTGGAAGTGTCCCGG - Intronic
1105996465 13:25677289-25677311 CTATGATGCTCGAAATGTTCTGG - Intronic
1106563212 13:30864139-30864161 GTAGGCTGCCTGTAGTGTCCCGG - Intergenic
1107720626 13:43244772-43244794 GTATGCTGCTGGCAGAGTCCGGG - Intronic
1109216789 13:59598284-59598306 CCATGATGCTTAAAATGTCCAGG + Intergenic
1116858256 14:49972952-49972974 CTTCTCTGCCTGAAGTGTCCAGG - Intergenic
1121456367 14:94041293-94041315 CGATGCTGTCTGAAATGTCCGGG + Intronic
1121885464 14:97538840-97538862 CCACCCTGCTTGAAATGTCCTGG + Intergenic
1124871769 15:33550544-33550566 CTATGCTCCTTGCACTTTCCAGG - Intronic
1128911214 15:71517044-71517066 GTCTGCTGCTTTAAGTGCCCTGG - Intronic
1129671455 15:77610148-77610170 CTGTGCTGCTTTCAGTCTCCTGG + Intergenic
1138081592 16:54095762-54095784 ATATGGTGGTTGGAGTGTCCTGG + Intronic
1138105953 16:54287186-54287208 CTAAGCTGCTGAAAGTGGCCGGG - Intergenic
1143449856 17:7029637-7029659 CTGTGCTGCCTGCTGTGTCCTGG + Exonic
1143695089 17:8608726-8608748 CTATGCTGCTTTATGCCTCCAGG + Intronic
1144737767 17:17564458-17564480 CTCTCCTGCTTGTAGTTTCCTGG - Intronic
1148572187 17:48678798-48678820 CTATGCTTCTGGAAGGGTGCAGG - Intergenic
1148906720 17:50917074-50917096 CTATGGGGCTTGGAGTGCCCTGG - Intergenic
1151162528 17:72177190-72177212 TTATGCTCCATAAAGTGTCCCGG + Intergenic
1152083669 17:78204590-78204612 CTACGCTGCTTCCTGTGTCCTGG - Intronic
1155617264 18:27736910-27736932 CTTTTCTGCTTGAAGTGTATAGG + Intergenic
1158073308 18:53499015-53499037 CTATATTGCTTGAACTGTCTGGG - Intronic
1160096823 18:75881033-75881055 TTATGCTGCTGGAAGTGTCACGG + Intergenic
1165062659 19:33212427-33212449 CTCAGCTCCTCGAAGTGTCCTGG + Exonic
1165653924 19:37516590-37516612 CCATGCTGCTAGAAGAGTGCCGG + Intronic
926499218 2:13632614-13632636 CTAAGCTGCTTGGAGTGTCATGG + Intergenic
927703685 2:25284031-25284053 CCATTCTTCTTGAGGTGTCCTGG - Intronic
931219469 2:60276319-60276341 CTATGCTGCTGGAACTGCCAAGG - Intergenic
931485672 2:62688932-62688954 CTTTGCTTCATGAAGGGTCCTGG + Intronic
931859285 2:66337044-66337066 CTATGCTCCTTTAAATGTCCAGG + Intergenic
933755813 2:85637635-85637657 CTGTGCTGGTTTAAGTGTTCTGG + Intronic
934551217 2:95263259-95263281 CTAGGCTGTTGGAAGTATCCAGG - Intergenic
936038300 2:109129539-109129561 CCATGCTGCTCGGAGCGTCCTGG + Exonic
1177356718 21:20018371-20018393 TTTTGCTGCTCGAATTGTCCAGG + Intergenic
1183319905 22:37158793-37158815 CTTGGCTGCTAGCAGTGTCCAGG - Intronic
1183415022 22:37676920-37676942 CTCCACTGCTCGAAGTGTCCGGG - Intronic
959100352 3:102002692-102002714 CAGTGATGTTTGAAGTGTCCTGG + Intergenic
962263541 3:133929577-133929599 CAAAGCTGGTTTAAGTGTCCCGG + Exonic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
973102904 4:46294613-46294635 CAATGATGCTTGAGGTGTCAGGG + Intronic
973975165 4:56255973-56255995 CAATGTTGCTTGAAGGGTCCTGG + Intronic
978369439 4:108015736-108015758 CTATGTTTCTTGAAGTGTGTAGG + Intronic
979270129 4:118749726-118749748 CTAGGCTGCTTAGAGTGTGCTGG - Intronic
980246959 4:130258575-130258597 CTTCCCTGCTTGAATTGTCCCGG + Intergenic
982423144 4:155221699-155221721 CAATGCTGAGTGAAGGGTCCTGG + Intergenic
989264618 5:39458576-39458598 TTATGCTCCTTGAAGAGTTCAGG + Intronic
994729757 5:103477737-103477759 CTATGCTGGGTGAGGAGTCCAGG - Intergenic
995035471 5:107529483-107529505 TTGTGCTGCCTGGAGTGTCCAGG - Intronic
995971296 5:117974257-117974279 ATATGCTGTTAGAAGTGGCCAGG + Intergenic
996921563 5:128773707-128773729 CTATCCTGTTTCAAGTGTCACGG - Intronic
998493466 5:142566711-142566733 CACTGCTGCAGGAAGTGTCCTGG + Intergenic
1000433608 5:161180563-161180585 ATCTGCTGATTGAAGAGTCCTGG + Intergenic
1001944540 5:175767752-175767774 ATATGCTGTTAGAAGTGGCCAGG + Intergenic
1002608793 5:180400185-180400207 CTATGCTCCTGGCAGTGGCCTGG + Intergenic
1003448066 6:6203317-6203339 CTATGTTGCTTTATGTGTCAAGG + Intronic
1004818266 6:19336128-19336150 CTAGGCTGCTTGAAGGGTGGTGG + Intergenic
1006123688 6:31823439-31823461 CCATGCTGCTAGAAATGGCCAGG + Intergenic
1013773674 6:113654594-113654616 CTGTGCTGCTGGCAGTGCCCTGG - Intergenic
1015381939 6:132579786-132579808 CCATGCTGCTTGAAATGTGTAGG - Intergenic
1019061240 6:169259693-169259715 CTGTGCTGTTTGCAGTGTCTGGG - Intergenic
1021982100 7:26065047-26065069 CATTGCTGCTTAAAGTGTCCTGG - Intergenic
1022763533 7:33383229-33383251 TTATGCTGATTGCAGTATCCAGG + Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026416306 7:70184324-70184346 CTATGCTGGGTAAAGTTTCCTGG + Intronic
1029584704 7:101462918-101462940 CTTTGATGCACGAAGTGTCCCGG - Intronic
1034510463 7:151530312-151530334 TTATGCTGTTTGAGGTTTCCCGG + Intergenic
1034674345 7:152881861-152881883 CTCTGCTCCTTGCGGTGTCCTGG + Intergenic
1037690502 8:21177666-21177688 ATGTGCTGCTTGTAGTCTCCGGG + Intergenic
1039838858 8:41279393-41279415 CTAGGCTGTTAGAGGTGTCCCGG - Intronic
1048326513 8:133443238-133443260 CTATGCTGCTGGAAGACACCTGG + Intergenic
1052551895 9:29962503-29962525 CTCTGCTGATTGAAGTGTCCAGG + Intergenic
1060370098 9:123060727-123060749 TTTTGCTGCTTGAAATGTCAGGG + Intronic
1203424557 Un_GL000195v1:25510-25532 GTCTCCTGCTTGAAGTGTCTAGG - Intergenic
1187793360 X:22975188-22975210 ACAGGCTGCTTGAAGTCTCCAGG - Intergenic