ID: 1088351905

View in Genome Browser
Species Human (GRCh38)
Location 11:108899184-108899206
Sequence CCAGAACTACTGCAGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088351905_1088351908 -7 Left 1088351905 11:108899184-108899206 CCTTTTCTCTGCAGTAGTTCTGG 0: 1
1: 1
2: 1
3: 23
4: 239
Right 1088351908 11:108899200-108899222 GTTCTGGAACTATCTTTATTGGG 0: 1
1: 0
2: 0
3: 20
4: 3331
1088351905_1088351907 -8 Left 1088351905 11:108899184-108899206 CCTTTTCTCTGCAGTAGTTCTGG 0: 1
1: 1
2: 1
3: 23
4: 239
Right 1088351907 11:108899199-108899221 AGTTCTGGAACTATCTTTATTGG 0: 1
1: 0
2: 0
3: 19
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088351905 Original CRISPR CCAGAACTACTGCAGAGAAA AGG (reversed) Intronic
900231815 1:1562857-1562879 CCAGGGCTTCTGCAGAGAGAGGG + Intronic
902711349 1:18242073-18242095 GCAGCACTACTGCAGACAGATGG - Intronic
902984617 1:20148115-20148137 CCAGGACTACTGCTGGGGAAGGG - Intronic
903458988 1:23507859-23507881 CAAGAATTACATCAGAGAAAAGG - Exonic
905080194 1:35312566-35312588 CTAGTACCACTGCAGGGAAATGG - Intronic
905867409 1:41383385-41383407 CCAGAACTGGCGCGGAGAAAGGG - Exonic
906104362 1:43283099-43283121 CAACAAGTGCTGCAGAGAAAGGG + Exonic
906318471 1:44802791-44802813 CCAGAAGTGCTGCTGAGACAGGG + Exonic
907278913 1:53332281-53332303 CCAGAGCTCCTCCAGGGAAAAGG - Intergenic
907658510 1:56370022-56370044 GAAGAACGACTCCAGAGAAAAGG + Intergenic
907836085 1:58109815-58109837 CTAGATCTCCTGCAGAGAAGGGG + Intronic
908684140 1:66695570-66695592 CCAGAACTTTTGAAGAGAACTGG - Intronic
909346654 1:74596745-74596767 CCAACACAAATGCAGAGAAAAGG + Intronic
911404459 1:97419362-97419384 CCGGAACTACAGCAGACTAATGG - Intronic
911870634 1:103093658-103093680 ACAGAACCACTCCAGAAAAAGGG - Intronic
912634832 1:111282369-111282391 CCAGAACAAATGAAAAGAAAGGG - Intergenic
915725073 1:158011589-158011611 CCAGACCTACCCCTGAGAAAGGG - Intronic
916533125 1:165677394-165677416 CCAGGCCTCCTTCAGAGAAATGG + Intronic
918392100 1:184076427-184076449 CCAGAAGTAAGGGAGAGAAATGG - Intergenic
918855723 1:189754550-189754572 CATGAACTACTGGAGAAAAATGG - Intergenic
919477440 1:198046609-198046631 CCAGGACTACTGAGGGGAAATGG + Intergenic
921268839 1:213449118-213449140 CCAGAATTTCTGCAGGGAAATGG + Intergenic
922366619 1:224871319-224871341 CCAGACGCACTGCAGAGAAGGGG - Intergenic
922936508 1:229426899-229426921 CTAGAAGGACTGCAGGGAAATGG - Intergenic
924205927 1:241711273-241711295 CCAGAACTACTGCAATAAACTGG - Intronic
1063139828 10:3245994-3246016 CCAAAACTCCAGCACAGAAATGG - Intergenic
1063536868 10:6891949-6891971 CCGGAACTACTGTAGGAAAAAGG + Intergenic
1064223412 10:13460942-13460964 CCAAAAATCCTGCAGTGAAATGG + Intronic
1064305633 10:14163749-14163771 ACAGAATTACTGCAAATAAACGG + Intronic
1065090188 10:22224621-22224643 CCAGGAATACTGCTGAGGAAAGG - Intergenic
1065095592 10:22277816-22277838 CCAGAGTTACTGTAGAGAAAGGG + Intergenic
1068801657 10:61147448-61147470 CCAGAATTGCTGCCAAGAAAAGG + Intergenic
1069286257 10:66719595-66719617 CCAGAAGTATTGCAGAGACCAGG + Intronic
1070657511 10:78281553-78281575 CAAGAGCCACTGCAGAGAAATGG - Intergenic
1070985368 10:80685477-80685499 ACAGAACTACTCGAGAGCAAAGG - Intergenic
1072814117 10:98488102-98488124 CCAGAACCTCTCTAGAGAAACGG - Intronic
1073051966 10:100673026-100673048 TCAGACCTACTGCAGGCAAAGGG + Intergenic
1073710573 10:106033295-106033317 CAAGATCCACTGCAGAGACAAGG + Intergenic
1074395165 10:113091885-113091907 CCATGGCTAATGCAGAGAAAAGG - Intronic
1075044272 10:119133688-119133710 CCACCAGCACTGCAGAGAAATGG - Intronic
1075432601 10:122401084-122401106 CCTTTACCACTGCAGAGAAAAGG + Intronic
1076444269 10:130501220-130501242 GCAGACCTACTGCAGAGGAGGGG + Intergenic
1076895191 10:133308135-133308157 TCAGATCTACTGCAGAGAATGGG - Intronic
1077048534 11:556486-556508 CCGGAACTCCTGCAGAGGTAAGG - Exonic
1078508001 11:11966330-11966352 CAAGAAGTAGTGGAGAGAAAAGG + Intronic
1078727567 11:13945340-13945362 TCAGAACTGCTTTAGAGAAAAGG - Intergenic
1078825917 11:14930239-14930261 CCAGAAGTCCTGCAGAAACAAGG - Intronic
1079248009 11:18767376-18767398 CCAGCACTCCTGCAGAGAGGAGG + Intronic
1080108562 11:28539661-28539683 CAAGAACTAGTGCAGTGAGAAGG - Intergenic
1082204477 11:49415746-49415768 TCAAAAATACTGCAGAGGAAAGG + Intergenic
1083775524 11:64892818-64892840 CCAAAGCTTCTGGAGAGAAAGGG + Intergenic
1084653695 11:70503196-70503218 CCACAGCTGCTGCAGAGGAAGGG + Intronic
1084664964 11:70571400-70571422 CCAGGCCTTCTGCAGAGAAAGGG + Intronic
1086157211 11:83680647-83680669 GCAGAACTTATTCAGAGAAACGG + Intronic
1086512877 11:87578832-87578854 CCATAATTAATGCAGAGTAAAGG + Intergenic
1088151100 11:106746414-106746436 CCAGTACTACTACAAACAAAAGG + Intronic
1088351905 11:108899184-108899206 CCAGAACTACTGCAGAGAAAAGG - Intronic
1089150385 11:116359287-116359309 CCAGACCTGCTGCTGAGAAAGGG + Intergenic
1089720089 11:120409580-120409602 CATGATCTACTGCAGGGAAAGGG + Intronic
1089948679 11:122505425-122505447 ACAGAACTGCTACATAGAAAAGG - Intergenic
1090102325 11:123812477-123812499 CCAGTAAGGCTGCAGAGAAAAGG - Intergenic
1090244998 11:125209879-125209901 CCAGAACTGCAGCAGAGACCAGG - Intronic
1090658526 11:128863795-128863817 CCAAAAATAGTGCAGAGAACAGG - Intronic
1092975215 12:13738177-13738199 TCTGAAGTACTGCAGATAAAAGG - Intronic
1093641336 12:21529770-21529792 TCAGAACTCTTGCAGTGAAAAGG + Intronic
1098046171 12:66402888-66402910 TCAGAACGAATGCAGAGAAAGGG + Intronic
1098732030 12:74048489-74048511 CCAGAACTTCTCCAGAGACATGG + Intergenic
1099752321 12:86791726-86791748 CTGGAACTAATGCTGAGAAAGGG - Intronic
1100908157 12:99325651-99325673 CCAGATCAGCTGCAGACAAACGG + Intronic
1101341711 12:103847887-103847909 CCAGAAGTACAACATAGAAAAGG - Intergenic
1102101737 12:110283493-110283515 AAAGAACTACAGCAGAAAAAGGG + Intronic
1103202735 12:119101716-119101738 ACAGAAATAAGGCAGAGAAATGG + Intronic
1103613606 12:122138651-122138673 GCAGAACTACTGCAGCAAAGAGG - Intronic
1104668103 12:130661915-130661937 ACAGAAATAGTGCAGAGAAGAGG - Intronic
1105945769 13:25188198-25188220 CTAGAATTTCTGTAGAGAAAAGG - Intergenic
1108036730 13:46297964-46297986 CCAAAACTTCTGCTGAGACATGG - Intergenic
1109390409 13:61684666-61684688 CCAGAATCACTGCACAGAAATGG + Intergenic
1110294602 13:73849083-73849105 CCAGAAGTACTGCAAAAATATGG + Intronic
1111144024 13:84157269-84157291 CCAGAATCTCTGCACAGAAAGGG + Intergenic
1113010326 13:105757833-105757855 TCAGAACCAAGGCAGAGAAATGG - Intergenic
1113822927 13:113228024-113228046 GCAGGACCACTGCAGACAAATGG + Exonic
1114674839 14:24432760-24432782 CCAGAAGTACTGCACAGCAATGG - Exonic
1115628735 14:35221739-35221761 CCAGAACAACCGCTCAGAAAAGG - Intronic
1117880098 14:60304850-60304872 CCAGAAGCACTTCAGAGATAAGG - Intergenic
1118244229 14:64093079-64093101 CCAGAAATACTTAAGAGCAAAGG + Intronic
1120091302 14:80335533-80335555 CCAGAGCTCCTCCACAGAAAAGG + Intronic
1120426418 14:84353402-84353424 CTAGAAAGATTGCAGAGAAAAGG + Intergenic
1121839764 14:97123461-97123483 ACAGAACTACTGCAGAGAAATGG - Intergenic
1125370488 15:38971421-38971443 ACAGAAAAACTGCAGAGAAAGGG + Intergenic
1126291588 15:47086368-47086390 CCAAAATTACTCCAGAGGAATGG + Intergenic
1126492640 15:49256323-49256345 CCAGAGCTTCTGCAGGGAACAGG + Intronic
1127020203 15:54738206-54738228 CCAGAACAGCAGCATAGAAAGGG + Intergenic
1127105882 15:55614531-55614553 ACATAACCACTGAAGAGAAAAGG + Exonic
1128037818 15:64541954-64541976 ACAGATCCACTGAAGAGAAAGGG - Intronic
1132185546 15:99799288-99799310 CCAAATCTACTGCAGAGCAGGGG - Intergenic
1132431449 15:101765253-101765275 CCAAATCTACTGCAGAGCAGGGG + Intergenic
1132635181 16:940767-940789 CCGGAAGTACTGCAGGGTAAAGG + Intronic
1135432064 16:22393195-22393217 ACAGATAGACTGCAGAGAAAAGG - Intronic
1135841453 16:25880460-25880482 CAAGAACTACTGTAAAGAGATGG - Intronic
1137547144 16:49411977-49411999 CCAGCCCTGCAGCAGAGAAAAGG + Intergenic
1137806791 16:51314084-51314106 CTAAAAGTACTGCAGAGAAGAGG - Intergenic
1138367754 16:56495828-56495850 CCACAACTATTTCAGACAAAGGG - Intronic
1139458202 16:67100826-67100848 CCTGTACTACTGGAGAAAAAGGG - Exonic
1140289763 16:73642286-73642308 CCAGAAAGACTGCAGAGGAGAGG - Intergenic
1141414868 16:83862885-83862907 CCAGAACTTCTGCAAAGATGAGG + Intergenic
1143575214 17:7788297-7788319 CCAGAACAACTTCTGGGAAACGG + Intronic
1146969670 17:37062491-37062513 CCAGCATTCCTGGAGAGAAATGG - Intergenic
1147238535 17:39075331-39075353 CCAGAGCAACTTCAGAGTAATGG + Intronic
1147606227 17:41775305-41775327 CCAGAACTCCTCCTGAGGAAGGG + Intronic
1149020799 17:51962138-51962160 CCACAATTTCTGCACAGAAAGGG - Intronic
1149054035 17:52341217-52341239 CCAAAACTTCTGCACAGCAAAGG - Intergenic
1152570255 17:81118547-81118569 CCAGATCTGCTGCAGGGAAGGGG - Intronic
1152937046 17:83145237-83145259 CCAGTGCAACTGCAGAGGAAGGG - Intergenic
1157715065 18:49879229-49879251 CCTCACCTACTGCAGAGCAAAGG + Intronic
1158153950 18:54404372-54404394 ACAGACCTACTGCAGAGAGATGG - Intergenic
1162087243 19:8256222-8256244 CCATGACTCCTGCAGGGAAATGG - Exonic
1164524657 19:29004481-29004503 CCACCACTACCGCAGGGAAAAGG + Intergenic
1164550633 19:29208979-29209001 AGAGAACTACAGCAGTGAAAAGG - Intronic
1167119960 19:47510977-47510999 CCAGAAATAATGAAGAGCAAGGG + Intronic
926125078 2:10267031-10267053 TCAGAACCTCTGCGGAGAAAGGG - Intergenic
926228976 2:10988631-10988653 CCAGACCCACTGCAGAAACAAGG + Intergenic
927028815 2:19099310-19099332 CCAGACTTACTGGAGAGAGATGG - Intergenic
927082163 2:19641248-19641270 CCTGAACTCTTGCAGAGAATCGG + Intergenic
928799316 2:35067775-35067797 CCAGAATTTCTGCATAGGAAGGG - Intergenic
931974920 2:67632951-67632973 GCAGCACAACTGAAGAGAAAAGG + Intergenic
933813111 2:86045352-86045374 GAAGAACTCCTGCAGAGAATGGG + Exonic
936978945 2:118246201-118246223 CCATAACAATTGAAGAGAAAAGG + Intergenic
937708712 2:124952342-124952364 CCAGCACTTCTGGAGAGGAAGGG + Intergenic
938999937 2:136722639-136722661 CTGGCACTACTGCAGAGAAAAGG - Intergenic
939668394 2:144978771-144978793 ACAGAACTCCTAAAGAGAAATGG - Intergenic
940769181 2:157822164-157822186 CCAGAACTACTTCAGAAAGCAGG + Intronic
941473229 2:165916574-165916596 CCAGAACTACTGAAATAAAAAGG - Intronic
942941303 2:181620919-181620941 CCAGACTTACTGAAGACAAAGGG + Intronic
943495380 2:188613653-188613675 ACACAACAAATGCAGAGAAAAGG - Intergenic
943667916 2:190629817-190629839 CCAGATCAGCTGCAGACAAAAGG + Intergenic
944496387 2:200311285-200311307 TTAGAACTACTGAAGAAAAATGG - Intronic
944634893 2:201666179-201666201 CCAGAACTACAGAAGATAGATGG + Intronic
945179093 2:207073791-207073813 CCAGAGCTACTGAAGACACAGGG + Intergenic
945685243 2:212960957-212960979 CCGGACCTACTGTAGAGACAAGG + Intergenic
945831533 2:214792804-214792826 CCAAAACTACTGCAGACACTGGG + Intronic
946754854 2:222933595-222933617 ACAGAACTACTCCAGAGGAATGG + Intronic
947272440 2:228352235-228352257 CCAGAACACCTGCTGAGAGAAGG - Intergenic
947523987 2:230867451-230867473 ACAGAGCTACAGCTGAGAAATGG - Intronic
948188723 2:236042237-236042259 CCAGGACTGCTCCAGACAAAAGG + Intronic
948420261 2:237855277-237855299 CTAGAGCTACTGCAGAAAACCGG - Intergenic
1169699183 20:8427625-8427647 CCAGAACTCCTTCAGGGAGATGG - Intronic
1170093105 20:12614988-12615010 CCATAACTACTGCAAAGGCATGG - Intergenic
1170460637 20:16573651-16573673 CCTGAACAACTGGAGAGAAGAGG + Intergenic
1172148174 20:32771966-32771988 GAAGAAATGCTGCAGAGAAATGG + Intronic
1172507715 20:35476050-35476072 AAAGAAGTAGTGCAGAGAAAGGG - Intronic
1173249751 20:41358205-41358227 CCAGAACCACAGCAGGGAAGGGG - Intronic
1173668410 20:44779733-44779755 CCTGAAGAACTGCACAGAAATGG - Intronic
1175314839 20:58040033-58040055 CCAAAACTCCTGCACAGAAGAGG + Intergenic
1176006311 20:62865252-62865274 CCAGAAGTCCTTCAGACAAAAGG + Intergenic
1176092136 20:63322895-63322917 CCAGCACAACCGCAGACAAAGGG - Intronic
1177489155 21:21799778-21799800 CCTGAAGTATTGCAGAGAAGAGG + Intergenic
1177746358 21:25219104-25219126 CCAGAATTAATGCAGATGAATGG - Intergenic
1178896373 21:36562019-36562041 GCAGAAGGAATGCAGAGAAAAGG - Intronic
1181102248 22:20549386-20549408 CTAGAACTGCTGCAGAAAAAAGG - Intronic
1182424524 22:30265139-30265161 CCAGACCTAAGGCAGAGAAGAGG + Exonic
1184261777 22:43321497-43321519 CCAGAGATGCTGCAGAGCAAAGG + Intronic
1184592128 22:45491905-45491927 CCATAACTATTGCTTAGAAATGG - Intergenic
950718306 3:14865068-14865090 ACACAACCACTGCAGGGAAATGG + Intronic
952460255 3:33517483-33517505 CTAGAAATACTTCAGATAAAAGG - Intronic
953138057 3:40200734-40200756 TCAGAGCCAATGCAGAGAAAGGG + Intronic
953221893 3:40979285-40979307 CCAACAGTACTGCAGAGAAAGGG + Intergenic
954235666 3:49255300-49255322 ACAGAACCACAGCAGTGAAAAGG - Intronic
954527308 3:51283476-51283498 CTAGAAGCAATGCAGAGAAAGGG + Intronic
954809708 3:53240441-53240463 CCTGACCTTCTGCAGAGGAAGGG - Intronic
955743791 3:62120278-62120300 CCAGAGGAACTGCAGAGAAGTGG + Intronic
956805991 3:72811952-72811974 CCAGAACTAATACATACAAATGG + Intronic
958679026 3:97302156-97302178 TCTGAAATACTGTAGAGAAAGGG - Intronic
959104338 3:102049271-102049293 CCAGAAAGGTTGCAGAGAAAAGG - Intergenic
960735508 3:120775138-120775160 CCAGAACAAGTGAAGAGTAAGGG + Intronic
960947237 3:122975049-122975071 CCACAAGGACAGCAGAGAAATGG + Intronic
962478900 3:135781436-135781458 CAAGAAGTATTGCAGAGACAGGG + Intergenic
963180422 3:142349561-142349583 ACAGTACTACTTCAGAGAAAAGG + Intronic
964358990 3:155874584-155874606 GAAGAACTGCTGCAGACAAAAGG + Intronic
965795007 3:172430430-172430452 TCAGAACAAATGCTGAGAAAAGG + Intergenic
965795671 3:172436360-172436382 CCAGTACTATTACAGACAAAGGG + Intergenic
967365110 3:188677607-188677629 ACAGAACTTCTGCTGGGAAATGG + Intronic
967453878 3:189658408-189658430 CCAAAAATACAGCATAGAAAGGG + Intronic
968354715 3:198096232-198096254 CCTGAACCACTCAAGAGAAAAGG + Intergenic
970941232 4:21636357-21636379 ACAGAACTACTGCCAAGAAACGG + Intronic
971316412 4:25571783-25571805 CCACATCCACAGCAGAGAAAGGG - Intergenic
974172421 4:58282907-58282929 TCACAACATCTGCAGAGAAAAGG + Intergenic
974392390 4:61288806-61288828 CAAGAACTAAACCAGAGAAATGG - Intronic
974682767 4:65184583-65184605 ACATAACTACAGCAGTGAAAAGG + Intergenic
974916242 4:68182330-68182352 CCAGAATTACTGCACCGAAGTGG + Intergenic
976348821 4:84036676-84036698 CCAGAATTTCTACAGAGAAAGGG - Intergenic
977490736 4:97706775-97706797 CCCCAACTACTCCACAGAAATGG - Intronic
979076696 4:116279792-116279814 AAAGAACTTCTGCAAAGAAAAGG + Intergenic
979562561 4:122116891-122116913 CCAGAATTACTGGAGAACAATGG + Intergenic
979951442 4:126898206-126898228 AACGAACTAATGCAGAGAAATGG - Intergenic
980261944 4:130460684-130460706 CAAGAACTACTGTATATAAAAGG + Intergenic
982143231 4:152351394-152351416 CCATACCTACTGGAAAGAAATGG + Intronic
986823754 5:11497973-11497995 CCAGAACAACTGCACATCAAAGG + Intronic
987400844 5:17475008-17475030 TAAGAACTTCTGCACAGAAAAGG + Intergenic
987643310 5:20639135-20639157 CCAGAAAGGATGCAGAGAAAAGG + Intergenic
987761442 5:22167552-22167574 CCAGGCCTACAGAAGAGAAATGG - Intronic
988354611 5:30157473-30157495 TCAGATCTCATGCAGAGAAAAGG - Intergenic
989373420 5:40733722-40733744 CTAGCACTACTGCTGAGAACAGG + Intronic
991896236 5:71401020-71401042 CCAGGCCTACAGAAGAGAAATGG - Intergenic
992186893 5:74252680-74252702 GCAGACCTACTGAATAGAAATGG - Intergenic
992216027 5:74525346-74525368 CCAAAACTTCTGCAGAGTAATGG - Intergenic
993614994 5:90100119-90100141 CCAGAAAAACTAGAGAGAAAGGG - Intergenic
994551635 5:101241246-101241268 CCAGCAGTAGTGCAGAGAAGGGG + Intergenic
996196119 5:120609786-120609808 CCAGAAACAGTCCAGAGAAATGG - Intronic
996341225 5:122441234-122441256 TCAGTCCTACTACAGAGAAAGGG - Intronic
996394000 5:122993809-122993831 CCATATCTACTTCAGAGATACGG - Intronic
997811940 5:136979103-136979125 ACAGAACTGCTGCAGACAAAGGG - Intronic
1000810610 5:165857005-165857027 TCAAAACTTCTGCAAAGAAATGG + Intergenic
1003364172 6:5456908-5456930 CCAAAACAACAGCAGGGAAAGGG + Intronic
1003448141 6:6204230-6204252 CCAGAAATGTTTCAGAGAAAAGG + Intronic
1003962973 6:11226174-11226196 CAGGAATTACTGCAGAGAGATGG + Intronic
1004039062 6:11957294-11957316 CTGGAACGGCTGCAGAGAAAAGG - Intergenic
1004997538 6:21208380-21208402 CCAGAACCAGTGAAGTGAAAGGG + Intronic
1005456643 6:26026357-26026379 CCAGTCCTACTCCAGAGAAGGGG + Intergenic
1006723496 6:36177473-36177495 CCATAAATACTCCAAAGAAAAGG - Intergenic
1007081190 6:39105705-39105727 CCAGCACGACGGCAGAGGAATGG + Exonic
1007394556 6:41570155-41570177 CCAGCAGTCCTGAAGAGAAATGG - Intronic
1011428533 6:87257857-87257879 CAAGAACTTCTACAGAGTAATGG + Exonic
1013568135 6:111390660-111390682 CCTCAACTACTGCTGAGATAGGG + Intronic
1013617132 6:111854016-111854038 CCAGCACTTTTGCAGACAAAGGG - Intronic
1014151931 6:118067317-118067339 TCAGGACTAGTGCAGAGAAATGG + Intronic
1021093107 7:16506001-16506023 CAAGAACTATAGCAGTGAAATGG + Intronic
1021929186 7:25562527-25562549 TCATAACCACTGCAGAGAACAGG - Intergenic
1022690536 7:32647764-32647786 CCAGATGTAATGCAAAGAAAAGG + Intergenic
1023406251 7:39835775-39835797 CCAGAAATGCTGCAAAGATAGGG - Intergenic
1025150299 7:56541998-56542020 CCAGGGCTGCTGCAGTGAAAGGG - Intergenic
1031582700 7:123496616-123496638 ACAGATTTACTGCAGACAAAAGG - Intronic
1035656231 8:1308182-1308204 ACAGAACGCCTGCAGAGAATGGG + Intergenic
1036977507 8:13430564-13430586 TCAAAAGTACTGCAGAAAAAAGG - Intronic
1037073108 8:14676878-14676900 CCAGATTTACTGCAAAGATAAGG + Intronic
1037996781 8:23358456-23358478 CCAGCACTAATGCAGAAGAAAGG - Intronic
1038007151 8:23441752-23441774 ACAGAACTAATCCAGAGAACTGG + Intronic
1038967096 8:32586770-32586792 CCAGAACTGTTGCAGATGAAAGG + Intronic
1039677717 8:39688104-39688126 CCAGTAAGGCTGCAGAGAAATGG - Intronic
1040355779 8:46617269-46617291 GCAGAGCTACTCCAGAGAGAAGG - Intergenic
1040606189 8:48934032-48934054 CAAGACCTGCTGCAGAGGAATGG + Intergenic
1042540171 8:69900191-69900213 CTAGAACTACTGAAATGAAAAGG - Intergenic
1042792396 8:72623104-72623126 ACAGAAATGCTGCAGTGAAATGG - Intronic
1044320815 8:90798932-90798954 CTGGAGCTGCTGCAGAGAAAAGG - Intronic
1044342127 8:91058083-91058105 CCAGAACAACTGCATAGATGAGG + Intergenic
1044773854 8:95667096-95667118 CCAGAACTACTGGAAACAGATGG - Intergenic
1047994679 8:130323082-130323104 AGACAACTACTGCACAGAAATGG + Intronic
1048399467 8:134050891-134050913 CCAGAGCTACTGCTGAGCACTGG + Intergenic
1049034917 8:140067776-140067798 TCAGAGCTCATGCAGAGAAAAGG + Intronic
1051046311 9:12878784-12878806 ACAGAACTACTGGAGTAAAAGGG + Intergenic
1053064240 9:35056383-35056405 CCAGTGATACTGCAGACAAAGGG + Exonic
1055304709 9:74917634-74917656 AAATAAATACTGCAGAGAAAGGG + Intergenic
1055379090 9:75686718-75686740 CCAGAACAAATCCAGAGAAAGGG - Intergenic
1056448902 9:86695644-86695666 CCAGATCTACGGTAGAGGAAAGG + Intergenic
1057291533 9:93810277-93810299 CCAGAATTCCTGCAGAGGAGGGG + Intergenic
1058061843 9:100505648-100505670 CCTGAAGTACTGCAAAGGAAAGG - Intronic
1060515206 9:124261248-124261270 CCAGAGCTACTGGAGAGAAAGGG + Intronic
1060594396 9:124839756-124839778 CCTGAACTTCTGGAAAGAAATGG + Intergenic
1186840367 X:13478931-13478953 CTGGAAATACTGCAGAGAACAGG - Intergenic
1193288778 X:79746009-79746031 CCAGAAATGTTGCAGGGAAAGGG - Intergenic
1194266466 X:91759116-91759138 CCTAAACTACTGCTTAGAAATGG - Intergenic
1195450472 X:105006249-105006271 TCAGAACTACTGCAGAAAGGAGG + Intronic
1196038956 X:111180277-111180299 TCAAAACTAATGCAGTGAAAGGG - Intronic
1196043040 X:111226434-111226456 CCAGCACTACTTCACAGGAAAGG - Intronic
1199143408 X:144336398-144336420 CCAGGAGCACTGCAGAGAACGGG + Intergenic
1199868958 X:151879034-151879056 CAAGAACAACTCCAAAGAAAAGG - Intergenic