ID: 1088352782

View in Genome Browser
Species Human (GRCh38)
Location 11:108909178-108909200
Sequence TCCAGGGAGGTGGGGGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 1, 2: 3, 3: 57, 4: 572}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088352782_1088352795 -7 Left 1088352782 11:108909178-108909200 CCTATTCCCCCCACCTCCCTGGA 0: 1
1: 1
2: 3
3: 57
4: 572
Right 1088352795 11:108909194-108909216 CCCTGGAAGGGAAGGGTGGCTGG 0: 1
1: 0
2: 5
3: 59
4: 594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088352782 Original CRISPR TCCAGGGAGGTGGGGGGAAT AGG (reversed) Intronic
900292354 1:1928915-1928937 TCCGGGGAGGTGGAGGGAAGTGG - Intronic
900479163 1:2889893-2889915 TGGAGGGAGGTGGGGGGAGGTGG + Intergenic
900479182 1:2889933-2889955 TGGAGGGAGGTGGGGGGAGGTGG + Intergenic
900489344 1:2939119-2939141 TCCTGAGAGTTGGGGGGGATGGG + Intergenic
900582275 1:3415106-3415128 CCCAGGGAGGTGGTGGGCAGGGG + Intronic
901426010 1:9182693-9182715 GACAGGGTGGTGGGGGGAAGGGG + Intergenic
901740775 1:11340257-11340279 TCCAGGGAGCTGGAGAAAATCGG - Intergenic
901851736 1:12020051-12020073 TCCTTGGAGGTGGGGGGCAAGGG + Intronic
901889026 1:12246116-12246138 TGCAGGGAGGTGGAGTGAGTGGG + Intronic
901905534 1:12406153-12406175 TCCAGCAGGGTGCGGGGAATTGG + Intronic
902184792 1:14717172-14717194 TCCAGTGAGTAGGGGGGAGTGGG - Intronic
902245543 1:15118294-15118316 TGCTGGGAGGTGGGGGGAGGGGG - Intergenic
902364370 1:15961794-15961816 ACCAGGGAGGTGGGGGGAATGGG + Intronic
902399573 1:16150655-16150677 GCCTGAGAGGTGGGGGGAACTGG - Intronic
902399776 1:16151556-16151578 TCCAGGGTGGAGGAGGGAAGAGG + Intronic
902513928 1:16980030-16980052 TCCTGGGAGGTGGGGGACAGGGG + Intronic
902966918 1:20011879-20011901 TCCAGGGGGTGGTGGGGAATGGG + Intergenic
903019930 1:20386821-20386843 TGCTGGGAGGTGGGGGGCAGGGG - Intergenic
903787594 1:25871703-25871725 TGCAGGGAGGTGGTGGAAAATGG + Intergenic
903903343 1:26665045-26665067 TGCAGGTAGGTTGGGGGATTTGG + Intergenic
904355055 1:29933512-29933534 TCCAGAGAGGTGGAGTGAAGGGG + Intergenic
904470697 1:30734226-30734248 TCCAGCGAGGTGGCTGGACTTGG + Intronic
904554729 1:31352309-31352331 TGCAGGGAGGAAGGGTGAATGGG - Intronic
904596087 1:31646441-31646463 TGCAGGGACGTGGATGGAATTGG - Intergenic
904641872 1:31937704-31937726 TGCGAGGAGGTGGGGGGAGTGGG - Intronic
904672256 1:32174678-32174700 TGCAGGGACCTGGGGGAAATTGG - Exonic
904756468 1:32771183-32771205 TGGAGGGAGGTGGGGAGAAGGGG - Exonic
905003220 1:34689721-34689743 TGCAGGAAGGTGGATGGAATGGG - Intergenic
906054487 1:42904580-42904602 TCCAGGGAGGTAGGAGGGAAAGG - Intergenic
907407857 1:54264640-54264662 TCAAGCGAGGTGGGGAGTATAGG + Intronic
909556792 1:76963093-76963115 ACCAGGGAGGTGGGATGACTAGG + Intronic
910149579 1:84126073-84126095 TCCTGGGGGGTGGGGGGGAGGGG + Intronic
911058854 1:93730809-93730831 TCAAGGGAGGTGGGGGAAGGAGG - Intronic
912467868 1:109886423-109886445 TCCTGGGAGGTGGAATGAATTGG + Intergenic
912523821 1:110266119-110266141 TCCAGAGCTGTCGGGGGAATTGG - Intronic
914978602 1:152391362-152391384 GCCTGGGAGGAGGGAGGAATAGG - Intergenic
915515374 1:156409578-156409600 CCCAGGGAGTGGGGTGGAATGGG - Intronic
915942924 1:160130255-160130277 TACATGGAGCTGGGGGGACTTGG + Exonic
916207652 1:162331069-162331091 TCCAGGAAGGTTGGCTGAATGGG + Intronic
917748064 1:178029758-178029780 GCCAGGGACCTGGGGGGAAATGG - Intergenic
918204994 1:182300315-182300337 GTCAGGGAGGAAGGGGGAATTGG + Intergenic
918819763 1:189237185-189237207 ACCAGGGAGGTGGGGGAGAATGG + Intergenic
918921115 1:190711661-190711683 GTCAGGGGGGTGGGGGGAAAAGG - Intergenic
919232942 1:194799165-194799187 AGCAGAGAGGTGGGGGAAATGGG + Intergenic
920051552 1:203167637-203167659 GGCAGGGAGGTGGGGGGATGGGG - Intergenic
921618878 1:217304606-217304628 TGCTAGGAGGTGGGGGGAAGAGG - Intergenic
922615248 1:226957283-226957305 ACCAGGGAGGTGGGGGGGGGGGG - Intronic
922737439 1:227995095-227995117 TGCAGAGAGGTGGGGGGGACAGG + Intergenic
924647656 1:245894077-245894099 TCCAGGGTGGAGTGGGGAATTGG + Intronic
1062916031 10:1241809-1241831 TGCAGGAATGTGGGGGGCATGGG + Intronic
1063006813 10:1979569-1979591 TCCAGGCAGATGGGGGGAAGCGG + Intergenic
1063438858 10:6055834-6055856 GGGAGGGAGGTGGGGGGAGTCGG - Intronic
1063623315 10:7667513-7667535 ACTGGGGAGGTGGGGGGAAATGG - Intergenic
1063957131 10:11277414-11277436 TCCAGGGAGGTGAGGGCAGAGGG - Intronic
1065133267 10:22643811-22643833 TTCAGGGAGGAGGAGGGAATGGG - Intronic
1065801283 10:29355442-29355464 TATAGGGAGGTGGGGGGCAAGGG - Intergenic
1067544231 10:47181312-47181334 TCCTTGGAGGTGGTGTGAATAGG - Intergenic
1067760175 10:49039120-49039142 TCCAGAGAAGTGGGGGGCAGAGG + Intronic
1068958776 10:62845404-62845426 GTCAGTGAGGAGGGGGGAATGGG + Intronic
1069579390 10:69554961-69554983 ACCAGGGAGGTGGGGAGAAGTGG - Intergenic
1069722716 10:70559978-70560000 CCCAGGGCGGTGGGGAGAAGGGG + Intronic
1069838399 10:71324000-71324022 TCCAGAGAGGTGGGGGCAGTAGG + Intronic
1069925404 10:71847023-71847045 TCCAGGCAGCTGTGGGGAAGTGG - Intronic
1070162037 10:73872710-73872732 TTCAGGGAGGTGGAGGATATGGG - Intronic
1070358063 10:75659631-75659653 GACTGGGAGGTGGGGGAAATGGG + Intronic
1070608842 10:77919382-77919404 TCCAAGGAGGTTGGGTGATTGGG - Intronic
1070912697 10:80132489-80132511 TCCCAGGAGGTGCGGGGACTCGG + Intronic
1071537292 10:86444660-86444682 CCCAGGGAGGAGGGGAAAATAGG + Intronic
1072044017 10:91636899-91636921 TTCAAGGAGGTAGCGGGAATTGG + Intergenic
1072291166 10:93966217-93966239 TACAGTGAGGTGGGAGGAACTGG + Intergenic
1072500716 10:96014998-96015020 GCCAGGGAGGTGGGGATAAGGGG - Intronic
1072608343 10:97001410-97001432 TCCAGGGAGGCAGGAGGAAGAGG + Intronic
1072611403 10:97019653-97019675 AGCAGGGAGGTGGGGGAAAATGG - Intronic
1072817338 10:98522410-98522432 TCCCGGGGGGCGGGGGAAATAGG + Intronic
1072970796 10:100015638-100015660 TCCAGGGTGGTGGGGAGGAGGGG + Intergenic
1073300040 10:102465632-102465654 GCCAGGGAGGTGGGTGGAGTTGG + Intronic
1073616859 10:105004797-105004819 TAGAGTGAGGTGGGGGGAAGTGG + Intronic
1073858110 10:107701246-107701268 TCCAGAGAGGTGAGGGGAGAGGG - Intergenic
1074365765 10:112856333-112856355 TCCAGGGTGGAGGTGGGAAATGG - Intergenic
1074562998 10:114551021-114551043 TCCAGGGAGGTGGATGGTGTGGG + Intronic
1075400634 10:122159092-122159114 TCCAGGGAGCTGGGGGAGCTGGG + Intronic
1075617900 10:123904871-123904893 TCCAGGTGGGTGGGTGGGATGGG - Intronic
1076178964 10:128391160-128391182 TCCAGGGTGAAAGGGGGAATAGG + Intergenic
1076541933 10:131220210-131220232 TCCAGGCTGTTGGGGGCAATAGG - Intronic
1076717428 10:132373452-132373474 TCCAGGGAGGGCGGGGGGAGAGG + Intronic
1076729155 10:132429675-132429697 GCCAGGGAGGAGGGGTGGATGGG - Intergenic
1076996360 11:299239-299261 TCCATCAAGGTGGGGGGAAGGGG - Intronic
1078085798 11:8232431-8232453 TACAGGGAGGTGTGGGGAAATGG + Intronic
1078381910 11:10850080-10850102 TCCAAGGAGGTTAGGGGAAAAGG + Intronic
1078566553 11:12419269-12419291 GCCTGGGGGGTGGGGAGAATGGG - Intronic
1078634089 11:13032861-13032883 TCCAGGGAGCTGGAGGAAAGAGG + Intergenic
1079007878 11:16804901-16804923 TGCAGGGAGGTGTGGGGAGGTGG + Intronic
1079097878 11:17522671-17522693 TCCAGGGAGGAGGAGGAAGTTGG + Intronic
1079128737 11:17735615-17735637 CCCCGGGAGGTGGGGAAAATGGG - Exonic
1079435957 11:20450641-20450663 ATCAGTGAGCTGGGGGGAATAGG + Intronic
1079616918 11:22506702-22506724 CCCAGGGAGGCGGGGGGGTTGGG - Intergenic
1079972120 11:27048254-27048276 GCCTGGGAGGTGGGAGAAATGGG - Intronic
1081005132 11:37726713-37726735 ACTAGAGAGGTGGGGGAAATTGG + Intergenic
1081808167 11:45901123-45901145 TCCTGGGAGGTGGGGCGGCTGGG + Intronic
1081909180 11:46689350-46689372 TACTGGGAGGAGTGGGGAATGGG + Intronic
1083186822 11:61022484-61022506 TCCGGGGAGGTTGGGGAAATGGG - Intergenic
1083388653 11:62332228-62332250 CACTGGGAGGTGGGGGGAGTAGG + Intergenic
1083443042 11:62689598-62689620 ACCAGGGAGGTGGGGGGAGGAGG - Exonic
1083890201 11:65592189-65592211 TCCAGGGCGCTGGGGAGAACGGG - Exonic
1084313953 11:68332803-68332825 TGGAGGGATGTTGGGGGAATTGG + Intronic
1084606015 11:70172264-70172286 TCCAGGAGGGTGAGGGGTATGGG + Intronic
1084686745 11:70700622-70700644 GCCAGGGAGGAGGGGGGCACAGG - Intronic
1084872088 11:72105203-72105225 TCCAGGGACCTATGGGGAATGGG - Intronic
1085102288 11:73811273-73811295 TCTAGGTAGGTGGGGTGGATGGG + Intronic
1085475824 11:76788290-76788312 TCGAGGGCGGTGGGGGGAGCTGG + Intronic
1086286965 11:85261952-85261974 TCCAGCCAGTTGGGGTGAATGGG + Intronic
1086675419 11:89601127-89601149 GCCGAGGAGGTGGGGGAAATGGG - Intergenic
1086879565 11:92137621-92137643 GCCAGGGAGTTCAGGGGAATTGG + Intergenic
1087208365 11:95420304-95420326 TCCAGGGAGGTGAGAGGAGCTGG - Intergenic
1087779633 11:102288602-102288624 TCGGGGGAGGTTGGGGGAGTAGG - Intergenic
1088208538 11:107424537-107424559 TCCTGGGAAGTGAGGGGAAGAGG - Intronic
1088352782 11:108909178-108909200 TCCAGGGAGGTGGGGGGAATAGG - Intronic
1088606539 11:111539018-111539040 TACAGGGAGGTGTGGAGAATTGG + Intergenic
1088683547 11:112265803-112265825 TCCAGGGAGCTGGGGGTAGCTGG + Intronic
1088743102 11:112782964-112782986 TGCCGGGAGGTGGGAGGAAGTGG - Intergenic
1089644403 11:119869174-119869196 TCCAGGGTGGTGGTCAGAATGGG - Intergenic
1089670328 11:120052422-120052444 TCCAGGATCATGGGGGGAATGGG - Intergenic
1091588469 12:1829157-1829179 TCCAGGGAGGTGGGGGGCGCAGG + Intronic
1091748761 12:3009948-3009970 CCCGGGGAGGTGAGGGGAGTGGG - Intronic
1094488966 12:30946790-30946812 TTCACGGAGGTGGGGGGTCTGGG + Intronic
1097037693 12:56134539-56134561 TTCAGGGAGGTGGGGAGTCTAGG - Intronic
1097225893 12:57476650-57476672 TCCTGGGAAGTGGAGGGAATGGG + Exonic
1098360334 12:69648235-69648257 TGGAGGGAGGTGGAGGCAATTGG + Intronic
1099784031 12:87237394-87237416 TGTAGGGGGGCGGGGGGAATCGG - Intergenic
1099892134 12:88602949-88602971 TGCAGGGGGGTGGGGGGAGGGGG - Intergenic
1100465911 12:94845158-94845180 TCCAGGGAGAGGTGGGGAACTGG + Intergenic
1100666119 12:96755466-96755488 GTCAGGGAGGGTGGGGGAATAGG - Intronic
1100844711 12:98645751-98645773 TCCAGGCCGGTGGAGGGAAACGG - Exonic
1101089157 12:101266970-101266992 TACAGGGAGGGGTGGAGAATTGG - Intergenic
1101603879 12:106233294-106233316 CCCACGGAGGTGGGGGAGATGGG - Intergenic
1101694456 12:107111803-107111825 TCCATGGAGGAGGGTGGAAGAGG - Intergenic
1101696793 12:107134664-107134686 TGGGGGGAGGAGGGGGGAATGGG - Intergenic
1101710001 12:107256462-107256484 CCCAGGGAGGGGAGGGGAAAGGG - Intergenic
1101814332 12:108134226-108134248 TACAGGGAGGAGGGAGGAAATGG - Intronic
1102201932 12:111063334-111063356 TGCAGGGTGGTGGGGGGAGGGGG - Intronic
1102418867 12:112788146-112788168 ACCAGGGAGGTGGGCAGGATGGG + Intronic
1102434953 12:112914887-112914909 ACAAGCGGGGTGGGGGGAATTGG - Intronic
1102503585 12:113369761-113369783 GCCAGGGACTTGGGGGGAGTGGG + Intronic
1103218250 12:119220420-119220442 AGCAGGGAGGTGGGGGTAACTGG - Intronic
1103904342 12:124319886-124319908 TCCAGGGAGATGGGGGTCAGGGG + Intergenic
1103932477 12:124457921-124457943 TACAGGGAGGTGGGGGGCGGAGG + Intronic
1104088208 12:125494246-125494268 TCCAGGGAGGAGGGGGAAGAGGG - Intronic
1104088390 12:125494785-125494807 TCCAGGGAGGAGGGGGAAGAGGG - Intronic
1104088432 12:125494896-125494918 TCCAGGGAGGAGGGGGGAGAGGG - Intronic
1104417712 12:128609188-128609210 TGCAGGGAGGTGGGGGTTACAGG - Intronic
1104546581 12:129718338-129718360 TCCAGGGAGGGGAGGGGAAGGGG + Intronic
1104623331 12:130334512-130334534 GCCAGGGTAGTGGGGGGAAGAGG + Intergenic
1105062564 12:133166619-133166641 TCCAGGCAAATAGGGGGAATGGG + Intronic
1105472355 13:20704601-20704623 TCAAGGGAGGTGGTGGGGGTGGG - Intronic
1105859387 13:24395459-24395481 TCCAGGGAGGTGCGCAGAAGGGG - Intergenic
1106002143 13:25734229-25734251 TACAGGAATGTGGGTGGAATGGG - Intronic
1106126861 13:26907780-26907802 GCCAGGGAGGTGGTGGGAACTGG + Intergenic
1106567210 13:30896628-30896650 TCCAGGGTGGATGAGGGAATAGG - Intergenic
1106658607 13:31774779-31774801 TGTAGGGAAGTGGGAGGAATAGG + Intronic
1107810264 13:44193760-44193782 CCCAGAGAGGTGGGAGGAAGAGG - Intergenic
1107980521 13:45730251-45730273 CACAGAGAGGTGGGGGGAACTGG + Intergenic
1108506310 13:51115654-51115676 GGCAGGGAGGTGGGGGTGATGGG + Intergenic
1109138834 13:58687831-58687853 TCCTGGGCGGAGGGGGGACTTGG + Intergenic
1110572418 13:77020406-77020428 TCCAAGGAGGAGGAGAGAATTGG - Intronic
1111128755 13:83946878-83946900 TCAAGTGAGTTGGTGGGAATGGG - Intergenic
1112130441 13:96517445-96517467 CCCAGGGAGATGGGGGGAGAGGG + Intronic
1115568995 14:34649481-34649503 TGAAGGGAGCTGGTGGGAATTGG - Intergenic
1116294879 14:43094430-43094452 TGCAGGGACGTGGGTGGAGTTGG + Intergenic
1116678298 14:47934719-47934741 TCAAGGGAGGTGGGTGGGCTGGG + Intergenic
1117474755 14:56082729-56082751 GCTATGGAGGTGGGGGGAAATGG + Intergenic
1117494285 14:56286339-56286361 TGCAGGGAGATGGGAGGAATTGG + Intronic
1117622468 14:57601455-57601477 TAGAGGGAGGAGGGGGGAAAGGG - Intronic
1118223621 14:63878378-63878400 TACAGGGAGCTGGGGAGGATTGG + Intronic
1118436121 14:65772236-65772258 TTCAGAGAGGTGAGGGGACTTGG + Intergenic
1118864481 14:69692181-69692203 TCCAGAGAAGTGGAGGGAAAAGG - Intronic
1120143648 14:80955726-80955748 CCCAGGGACCTGGGCGGAATGGG + Exonic
1120835518 14:89035453-89035475 TCCAGGGAGCAGGAGGGAAGCGG - Intergenic
1121016786 14:90553744-90553766 TTCAGGGAGGTGGGGAGAGTGGG - Intronic
1121078664 14:91090122-91090144 GCCAGTGAGGAGAGGGGAATGGG - Intronic
1121418722 14:93797466-93797488 GACAGGGAGGTGGGGGGCAGGGG + Intergenic
1121424407 14:93838477-93838499 TCCAGGGAGCTGGGGTGAGGGGG + Intergenic
1121885772 14:97541409-97541431 CCCAGGCAGGTGGGGGAAACAGG + Intergenic
1122329715 14:100904221-100904243 GCCAGGAGGGTGGTGGGAATGGG - Intergenic
1122861526 14:104584704-104584726 TCCAGGGGGGTGGCGGGGAGGGG - Intronic
1122993033 14:105247876-105247898 TCCTGGGAGGTGCGTGGCATGGG - Intronic
1123172569 14:106388537-106388559 ACCTGGGAGGTGAGGGAAATTGG + Intergenic
1123682325 15:22771615-22771637 TGCTGGGAGGTGGGGGGTACAGG - Intergenic
1123762299 15:23442373-23442395 TGCTGGGAGGTGGGGGGTACAGG - Intronic
1124334078 15:28844128-28844150 TGCTGGGAGGTGGGGGGTACAGG - Intergenic
1124497477 15:30195554-30195576 TCAAGGGAGGAGGGGGCAGTCGG + Intergenic
1124531933 15:30516195-30516217 TGCTGGGAGGTGGGGGGTACAGG + Intergenic
1124746096 15:32343111-32343133 TCAAGGGAGGAGGGGGCAGTCGG - Intergenic
1124766720 15:32491450-32491472 TGCTGGGAGGTGGGGGGTACAGG - Intergenic
1124801063 15:32833250-32833272 TAATGGGAGGTGGGGGGAAATGG + Intronic
1126254152 15:46605330-46605352 TCCAGTGATGTGGTGGGTATTGG + Intergenic
1126580538 15:50238621-50238643 TTCAGGGAGGTGTGGGGAAGTGG - Intergenic
1126662112 15:51043497-51043519 TCCAGGGGGGTGGGGGGCAAAGG - Intergenic
1127506350 15:59601527-59601549 GGCAGGGAGGTTAGGGGAATGGG + Intronic
1127811184 15:62566953-62566975 TCCTGAGAGGTGGGGGCTATGGG - Intronic
1128595262 15:68940255-68940277 TCCAGGGAAGTGAGAGGAAAAGG - Intronic
1128643810 15:69360287-69360309 TCAAGGTAGGTGGGGGAAGTAGG - Intronic
1128667937 15:69552400-69552422 TCAAGAAAGGTGGGGGGAAATGG - Intergenic
1129058385 15:72838864-72838886 ACTGGGGAGGTGGGGGGGATAGG - Intergenic
1129167546 15:73787300-73787322 GCCTGGGAGGTGAGGGGCATGGG + Intergenic
1129528386 15:76239535-76239557 GGCTGGGAGGTGGGGGAAATGGG - Intronic
1130451721 15:84061174-84061196 GGCAGGGAAGTGGGGGAAATTGG - Intergenic
1130460922 15:84157823-84157845 TCAGGGGAGGTGGAGGGAACTGG + Intergenic
1131422393 15:92318157-92318179 TGAAGGGAGGAGTGGGGAATGGG + Intergenic
1132117103 15:99145550-99145572 TGGAGGGAGGTGGTGGGGATGGG + Intronic
1132771617 16:1566842-1566864 GCCAGGGAGGTGGGGCCACTGGG - Intronic
1133249878 16:4474158-4474180 TCCAGAGATCTGGGGGTAATGGG + Exonic
1133725259 16:8531369-8531391 TCCAAGGAGGGGGTTGGAATGGG - Intergenic
1135031603 16:19043120-19043142 TCAAGGGAGGTGGGCGGAGACGG - Intronic
1135198371 16:20414031-20414053 TCTGGGGAGTTGTGGGGAATGGG + Intronic
1135597290 16:23754548-23754570 TCCTGGGGGGAGGGGGGAAGAGG - Intergenic
1136374302 16:29856273-29856295 TCCAGGGAGGTTGGGGGAGTGGG - Intergenic
1136450807 16:30353430-30353452 TCCAGGGAGGGTGGGGGTGTGGG + Exonic
1136566661 16:31074531-31074553 TCCCGGGAGGTGGGAGGGAAGGG - Exonic
1136845595 16:33573495-33573517 TTAAGGCAGGTGGGGGGACTGGG + Intergenic
1137702259 16:50505865-50505887 TCCTGGGAGGTTGGGGGGATGGG - Intergenic
1138531171 16:57635192-57635214 TCTAGGCAGGTGGGGGGCAGGGG - Intronic
1139297909 16:65919048-65919070 ACCAGGGAGGTGGAGGTAAGTGG - Intergenic
1139664713 16:68447788-68447810 CCAAGGGAGGAGGGGGGAATAGG + Intronic
1139934174 16:70556100-70556122 TCCAGGGTTTTGGGGTGAATTGG + Intronic
1140990133 16:80202737-80202759 TCCAAGGGGGTGGGAGGTATTGG - Intergenic
1141185497 16:81784180-81784202 TAGAGGGAGGTGGGGGCAAAGGG + Intronic
1141185760 16:81785957-81785979 TCCAGGGAGAAGGAAGGAATCGG - Exonic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142205231 16:88779779-88779801 TCCATGGAGCTGAGGGGAAGGGG - Intronic
1203107303 16_KI270728v1_random:1422148-1422170 TTAAGGCAGGTGGGGGGACTGGG + Intergenic
1142687006 17:1583186-1583208 TCCAGGTGGGTGTGGGGAGTGGG - Exonic
1143472379 17:7184029-7184051 ACCAGGGAGGTGGGGGACAGTGG + Intergenic
1143733912 17:8897114-8897136 TCCAGAGAGGCTGGAGGAATTGG + Intronic
1144446001 17:15329944-15329966 TCAATGGAGGAGGGTGGAATGGG + Intronic
1144701774 17:17345088-17345110 TCCTGGGAGCTGGGAGGAGTGGG + Intronic
1144944346 17:18962114-18962136 TCCAGGGAGGTGGCTGGCATGGG - Intronic
1145835753 17:27953047-27953069 TCCAGGGATGTGGGTGGGAGGGG - Intergenic
1145963825 17:28902969-28902991 TCCAGGGCGGTGCGGGGCCTGGG - Exonic
1146086794 17:29837837-29837859 TCCATGGAGCTGGGGGGAGCTGG + Intronic
1146939336 17:36833225-36833247 TCCTGGGAGGTGGGTGGGATGGG + Intergenic
1147132383 17:38417152-38417174 GCCAGGGAGGAGGGAGGACTGGG + Intergenic
1147239162 17:39079298-39079320 TCCGGGGAAGTAGAGGGAATGGG - Intronic
1147610880 17:41801280-41801302 AGCAGGGAGGTGGGGGCAAAGGG - Intergenic
1147884712 17:43676833-43676855 CCCAGGGAGGTGGCAGCAATAGG - Intergenic
1148020115 17:44547915-44547937 TCCAGGGAAGGAGGGGGAGTGGG + Intergenic
1148075387 17:44932637-44932659 TGCAGGGTGGGGGCGGGAATGGG + Intronic
1148124954 17:45231679-45231701 TGCAGTGGGGTGGGGGGATTAGG + Intronic
1148215591 17:45832577-45832599 TCCAGGGAGGCCTGGGGAGTGGG - Intronic
1148641075 17:49188080-49188102 TCCAGGGAGGTAGGAGGTAATGG + Intergenic
1148897155 17:50845634-50845656 TTCAGAGAGGTGGGAGGAAGAGG - Intergenic
1149363036 17:55913923-55913945 GGCAGGGTGGTGGGGGGAGTAGG + Intergenic
1149481942 17:57010679-57010701 CCCAGGGAGGTGGGGGGTGAAGG - Intergenic
1149950982 17:60985650-60985672 TGGAGGGAGGAGGGGGGAGTAGG - Intronic
1150209768 17:63435629-63435651 ACCAGGGAGGTGGGAGGAGGAGG - Intronic
1151325985 17:73379979-73380001 TCCAGGGGGGAGGGGCGCATTGG + Intronic
1151356619 17:73562443-73562465 TGGAGGGAGGTGGGAGGAACAGG - Intronic
1151443446 17:74148398-74148420 TGGGGGGAGGTGGGGGGAAATGG + Intergenic
1151475591 17:74342890-74342912 GCCAGGGAGGTGGTGGGGAGTGG - Intronic
1151573282 17:74937901-74937923 TCCAGGTGGGTGGGGAGGATGGG + Intronic
1151890817 17:76949492-76949514 TAGAGGGAGGGTGGGGGAATCGG - Exonic
1152077979 17:78170260-78170282 ACCGGGGAGGGGTGGGGAATGGG - Intronic
1152523169 17:80872409-80872431 TCCATGGGGGTGGGAGGAAGGGG - Intronic
1152926388 17:83089639-83089661 TCCAGGGCGGTGGGGAGGGTCGG - Intronic
1152946417 17:83200055-83200077 TCCAGGGAAGTGGGGACAGTCGG + Intergenic
1153054080 18:928309-928331 CCAAGGGAGGTGGGGTGGATGGG + Intergenic
1153409475 18:4777892-4777914 TCCAGGGATGTGGGGGAGCTAGG + Intergenic
1153549830 18:6250627-6250649 TTGAGAGAGGTGGGGGAAATTGG + Intronic
1153850663 18:9091083-9091105 TCCAGAGAGGTGGGGTGCAGGGG - Intergenic
1155166949 18:23239476-23239498 TCCAGGGAGCTGGGGGGTTGAGG - Intronic
1155529862 18:26756190-26756212 GCCAGGAAGTTGGGGGGAAAAGG - Intergenic
1155590143 18:27418608-27418630 ACCATAGAGGTGGGGGGAACAGG + Intergenic
1155984462 18:32215362-32215384 TATAGAGATGTGGGGGGAATGGG + Intronic
1156250070 18:35344234-35344256 TCCCGGGAGGCGCGGGGAACAGG - Intronic
1156281377 18:35642739-35642761 ACCAGGGAAGAGGGGGCAATAGG - Intronic
1156504318 18:37579507-37579529 CTCAGGGAGGAGGGGGGAGTTGG - Intergenic
1157404066 18:47408956-47408978 TCCAGAGAGGTGAGGGAACTTGG + Intergenic
1157424251 18:47571318-47571340 GGCAGTGAGGTGGGGGGAAGCGG + Intergenic
1157569864 18:48705113-48705135 TTCAGGGAGGGTGGGGTAATGGG + Intronic
1157888802 18:51394728-51394750 TCCAGTGAGCTGGGTGGAAATGG + Intergenic
1157958699 18:52127911-52127933 GAAAGGGAGGTGGAGGGAATAGG + Intergenic
1160570707 18:79815838-79815860 TCCAGGGCGGTGGGTGCCATCGG - Intergenic
1160672259 19:371284-371306 TCCAGGGAGGACCGAGGAATGGG + Exonic
1161236083 19:3198913-3198935 CCCTGTGGGGTGGGGGGAATGGG - Intronic
1161483909 19:4524686-4524708 TGGAGGGAGGTGGGGGGAAAGGG - Intronic
1161721722 19:5906329-5906351 CCCAGGGAGGTGGGAGGAGCTGG + Intronic
1161854297 19:6754558-6754580 TCTTGGGAAGTGGGGGGAATTGG + Intronic
1162208832 19:9075798-9075820 TGCAGGGAGGTGGGGGAAGGAGG - Intergenic
1163207746 19:15815839-15815861 CCCTGGCAGGCGGGGGGAATGGG - Intergenic
1163209233 19:15828500-15828522 TCCCGGGAGGTAGGGGGAGGGGG + Intergenic
1163668398 19:18613598-18613620 TCCAGGGAGGAGGGGAGACATGG - Intronic
1163779748 19:19240056-19240078 AGGAGGGAGGAGGGGGGAATGGG - Intronic
1163809408 19:19421252-19421274 GCCAGGGAGGTGAGGGCAGTAGG + Intronic
1164802844 19:31092010-31092032 TCCAGGGCTTTGGGGGGACTGGG - Intergenic
1165169325 19:33880065-33880087 GCCAGGGAGGGGGTGGGAACAGG - Intergenic
1165756679 19:38297329-38297351 ACCAGGGTGGTGGGGGGTAGGGG + Intronic
1165881305 19:39045940-39045962 GCCAGGGAGGTGGTAGGAAGAGG + Intergenic
1166329425 19:42069748-42069770 TCCAGGGGGGAGGGGGAAAGGGG - Intronic
1166377045 19:42333543-42333565 TGCAGGGAGGTGTGGGGAGAAGG + Intronic
1166655928 19:44611871-44611893 TCCAGGGAGGTGAGGGGCCCAGG - Intergenic
1166802219 19:45465347-45465369 TAGAGGGACGTGGGGGGCATAGG - Intronic
1167038519 19:47008482-47008504 TCCTGGGAGGTGGGCGGGGTCGG - Intergenic
1167259518 19:48450551-48450573 TCCCGGGAGGTCGGGGGAGCAGG + Intronic
1167324410 19:48815071-48815093 TCCAGCCTGGTGGGGGCAATCGG - Exonic
1167534656 19:50041970-50041992 TCCTGGGAGCTGGGGGGATCAGG + Intronic
1168061051 19:53892485-53892507 TGCAGGAAGGTGGGGTGGATGGG - Intronic
1168069762 19:53942906-53942928 TCCAGGGAAGTAGGGGAGATGGG - Exonic
1168211442 19:54893646-54893668 TCCAGGGAGGTGGCGGGGGGCGG + Intergenic
925725532 2:6867147-6867169 TCCAGAGAGGTGGATGGCATAGG - Intronic
926195732 2:10762704-10762726 GCCATGGAGGTGGGAGGGATGGG - Intronic
927461641 2:23304430-23304452 GCCAGGAAGGTGTGTGGAATGGG - Intergenic
929581500 2:43084280-43084302 TCCAGGGAGGTGGCGGGGCTGGG + Intergenic
930355083 2:50308254-50308276 GTCAGGGAGGTGGGGGGAGATGG - Intronic
931292046 2:60881715-60881737 TCTAGGGTGGTCGGGGGACTGGG + Exonic
932412760 2:71557076-71557098 TTCAGGAAGGTTGGGGGAAATGG - Intronic
932851724 2:75194193-75194215 TCCAGAGAGGAGGTGGGCATTGG + Intronic
932901831 2:75710565-75710587 TCCAGGGAGACGCGGGGAAGCGG - Intronic
933277450 2:80299355-80299377 TGGGGGGAGGTGGGGGGAAACGG - Intronic
933540105 2:83629333-83629355 GCTAGGGGGTTGGGGGGAATGGG - Intergenic
933652563 2:84861110-84861132 TACAGGGAGGTGAGGCCAATAGG + Intronic
933713119 2:85342322-85342344 TGCAGGGAGGTGTGGGGTAAGGG - Exonic
934050946 2:88210340-88210362 TCCAGGGAGGTGGTGGCATCTGG + Intergenic
934077721 2:88442048-88442070 TAAAGGGGGGTGGGGGGAGTGGG + Intergenic
934752543 2:96802816-96802838 TCCGGGGAGTCGGTGGGAATAGG + Intronic
934769213 2:96897194-96897216 TCCAGGGAGTGGGGGGGAATAGG - Intronic
934849623 2:97689615-97689637 CCCAGGCAGGGAGGGGGAATGGG + Intergenic
935390015 2:102541105-102541127 TCCAGGGATGTGGGTGGGGTAGG - Intergenic
935413428 2:102789097-102789119 GCGAGGGAGGTGGGGGGTAGTGG + Intronic
935752575 2:106249994-106250016 GGCAGGGAGGTGGGGAGAATAGG + Intergenic
935912995 2:107917539-107917561 GGCAGGGAGGTGGGGAGAATGGG + Intergenic
936250054 2:110861500-110861522 TGAGGGGAAGTGGGGGGAATAGG - Intronic
937481689 2:122268203-122268225 GCCTGGGAGGAGGGGGAAATGGG - Intergenic
938676777 2:133643898-133643920 TTCAGGCAGGGCGGGGGAATTGG - Intergenic
938904528 2:135825760-135825782 TCCGGGGAGAGGGTGGGAATGGG + Intronic
939529327 2:143337273-143337295 GCTAGGGAGGTGGGAGGAAGGGG + Intronic
940206915 2:151213176-151213198 TCCAGGGAAGAGGGGGAAATGGG + Intergenic
940636981 2:156309405-156309427 CCCAGGGAGGAGTGGGGAAGGGG + Intergenic
941833073 2:169983673-169983695 TACAGGGAGGAGTGGAGAATTGG + Intronic
941838462 2:170052677-170052699 GACAGGGAGGTGGGGAAAATGGG + Intronic
942315981 2:174696958-174696980 TCGAGGGAGGAAGGGGGAAGAGG - Intergenic
942742206 2:179194088-179194110 TCCAGCTAGTTGGGGAGAATGGG - Intronic
942743552 2:179206672-179206694 TCCAGGGAGTAGGGGGCAAATGG + Intronic
943731553 2:191308016-191308038 TCCAGGGAGGGGAGGGGAGCTGG - Intronic
944101605 2:196033449-196033471 TGGAGGGAGGCAGGGGGAATGGG - Intronic
947109061 2:226699038-226699060 CCCAAGGAGGGGAGGGGAATAGG + Intergenic
947748940 2:232522980-232523002 TCAAGGGGGGTGGTGGGAAGGGG + Intronic
948248200 2:236504100-236504122 GGCAGGGAGGAGTGGGGAATGGG - Intronic
949043340 2:241859249-241859271 CCCAGGGAGATGGGGGGGATGGG - Intergenic
1168762673 20:360189-360211 TCCAGGGTGGTGTGGGGGTTGGG - Intergenic
1169520753 20:6370451-6370473 TACAGGGAGGTGTGAAGAATTGG + Intergenic
1169931495 20:10837780-10837802 TCCAGGGAGGGGAGAGGAATTGG + Intergenic
1170534623 20:17327550-17327572 CCCAGGGAGGAGAGGGGAAGGGG - Intronic
1170768433 20:19311579-19311601 TCCTGGGAGGTGTGGGGTAAAGG + Intronic
1170960937 20:21025323-21025345 GGCTGGGGGGTGGGGGGAATAGG + Intergenic
1171100581 20:22379861-22379883 TACAGGGAGCTGTGGAGAATTGG + Intergenic
1172021805 20:31919942-31919964 TTCAGGGAGGAAGGGGGAAGAGG - Intronic
1172022618 20:31925102-31925124 GCTAGGGAGATGGGGGGAAGAGG + Intronic
1172477205 20:35247911-35247933 GACAGGGAGGTGGGGAGAAATGG + Intronic
1172645597 20:36467336-36467358 TCCAGGGAGGTGGGTGCAGAGGG + Intronic
1172950030 20:38717279-38717301 GACAGGGAGGTGGGAGGCATAGG - Intergenic
1173759874 20:45550063-45550085 GCAAGGTAGGTGGGGGGGATTGG + Intergenic
1173793640 20:45843774-45843796 TGCACGGAGGTAGGGGGAAAAGG + Intronic
1173932917 20:46836815-46836837 TTCAGGGAGGTGATGGGAGTAGG + Intergenic
1175433170 20:58921643-58921665 TCCTGGGAGGAGGTGGGATTTGG + Intergenic
1175620152 20:60437254-60437276 TACTGGGAGGTGGGAGGAACAGG - Intergenic
1175853368 20:62105496-62105518 TGCAGGGAGGTGGGGGGAGCAGG - Intergenic
1175891645 20:62318399-62318421 TGCAGGGAGGAGGCGGGAAGAGG + Intronic
1175926591 20:62474341-62474363 TCCAGGGAGGCGGGGGCCAGGGG + Intronic
1175987299 20:62770463-62770485 TGGAGGGAGGTGGGGGAACTAGG + Intergenic
1176073181 20:63237236-63237258 TCCAGGGAGGTGGGTGAGCTGGG - Intronic
1176077376 20:63254555-63254577 TGCGGGGAGGAGGGGGGAACGGG - Intronic
1176085446 20:63293643-63293665 TCCAGGGACTTGGGGGCACTCGG + Intronic
1176110263 20:63407723-63407745 TCCCAGGAGGTGGGGGGACCTGG + Intronic
1177805400 21:25870031-25870053 TCCATGGACCTGGGGGAAATGGG - Intergenic
1178913259 21:36693217-36693239 GCCAGGCAGGTGGGCGGAAGGGG - Intergenic
1179469787 21:41602835-41602857 TCTAGGGAGATGCAGGGAATTGG + Intergenic
1180694872 22:17745301-17745323 GCCAAGGAGTTGGGGGGAGTTGG - Intronic
1180981374 22:19879608-19879630 TGCAGGGTGGTGGGGGGGGTGGG + Intronic
1181058697 22:20271806-20271828 GCCAGGGAGCTGGGGGGTGTTGG + Intronic
1181971703 22:26695557-26695579 TACTGAGAGGTGGGGGGCATTGG + Intergenic
1182145126 22:27992836-27992858 CCCAGGAAGGTGGGTGGAAGTGG + Intronic
1182236688 22:28882505-28882527 TCCACGGAGGAAGTGGGAATTGG + Intergenic
1182349985 22:29693960-29693982 TCCAGGGAGATGCTGGGAAGTGG + Intronic
1182542376 22:31051009-31051031 TCCAGAGAGCTTTGGGGAATAGG + Intergenic
1183342994 22:37292408-37292430 TCCAGGGGGGTGGGAGAAACAGG + Intronic
1183393557 22:37559695-37559717 TCCATGGAGGTGGGCGGGGTGGG + Intergenic
1183649543 22:39145923-39145945 TCCCGGGGGGTCGGGGGAAGCGG + Intronic
1183734711 22:39637372-39637394 TCCAGGCAGATGGGGGGACAGGG + Intronic
1184289495 22:43490819-43490841 ACCAGGCAGGTAGGGGGAATGGG - Intronic
1184292748 22:43506749-43506771 GCCAGGGCGGTGGTGGGAACCGG + Exonic
1184481497 22:44750850-44750872 TCCAGAAGGGTGGGGGGAGTAGG + Intronic
1184493194 22:44822288-44822310 TGCAGGGAGGGAGGGGGAGTTGG - Intronic
1184828497 22:46969307-46969329 TCCTGCAAGGTGGGGGGAGTGGG - Intronic
1185037604 22:48488160-48488182 TCCAGGGAGGTGAAGGGATGTGG - Intergenic
1185048340 22:48540291-48540313 ACCAGGGCGGTGGGGGGAGGTGG + Intronic
1185077149 22:48689683-48689705 CCCAGGGAGCTGGGGTGAGTGGG - Intronic
949151053 3:767358-767380 CACAAGGAGGTGGGGGTAATCGG + Intergenic
949165162 3:931598-931620 GCCATGGAGGTGGGGAGAAGTGG - Intergenic
949200786 3:1377029-1377051 TCCATGGAGGTGGAGGAAGTCGG + Exonic
950002496 3:9668015-9668037 TCTAGTTGGGTGGGGGGAATGGG - Intronic
950141793 3:10620824-10620846 TCCAGGGAGGTGGCTGGTAGGGG - Intronic
950454376 3:13083975-13083997 CCCAGGGAGGTGAGGGGAAGGGG + Intergenic
950715982 3:14848115-14848137 TCCTGGGAGGTGGGTGGAGGAGG + Intronic
950870725 3:16226179-16226201 TTCTGGGAGGAGGGAGGAATGGG + Intronic
950881509 3:16326312-16326334 GCCAGGGAGGTTGAGGGACTTGG - Intronic
951467523 3:23018304-23018326 TCCAAGGATGCGGGGAGAATGGG - Intergenic
952416635 3:33096393-33096415 TCCAGGTTGAGGGGGGGAATAGG - Intronic
952532281 3:34274972-34274994 TCCAGTTAGGTGGGGACAATGGG + Intergenic
952983331 3:38756079-38756101 ACCAGGGTGGTGGTGGGATTAGG + Intronic
953296083 3:41718584-41718606 TGTAGGGAGTTGGGGGGAATGGG - Intronic
954699417 3:52443544-52443566 GCTAGGGAGGTGGAGGTAATGGG + Intronic
955600764 3:60642716-60642738 GCGGGGGAGGTGGGGGGAAGAGG - Intronic
955782145 3:62496278-62496300 TCCAGGGAGGTGCTGAGCATGGG - Intronic
957194603 3:77051326-77051348 TACAGGGAGGTGGGAGGCAAGGG - Intronic
957720476 3:83990749-83990771 TCCAGAGAGGTGAGGGGGAAGGG - Intergenic
958762221 3:98322894-98322916 GCCAGGGAGGTGGTATGAATGGG - Intergenic
959481617 3:106879525-106879547 AACTGGGAGGTGGGGGAAATGGG + Intergenic
960624794 3:119671861-119671883 CCCATGGAGGTTGGGGAAATAGG + Intronic
961987945 3:131157765-131157787 TCCAGTGACGCTGGGGGAATGGG + Intronic
962829004 3:139123399-139123421 TCCAGGGATGTGTGGGGTTTTGG - Intronic
962864282 3:139434533-139434555 TGCAGGGAGGTAGGGGGAACAGG - Intergenic
963004855 3:140717356-140717378 AGCAGGGAGGTGGGGGGAATGGG + Intergenic
964151546 3:153531688-153531710 GCCAGGGAGTTGGGGAGGATTGG - Intergenic
964277859 3:155026719-155026741 CTGGGGGAGGTGGGGGGAATGGG - Intronic
966301301 3:178482278-178482300 TCAAGGGGTGTGGGGGGAACTGG + Intronic
968186653 3:196637430-196637452 TCTTGGGATGTGGAGGGAATGGG + Intergenic
968300778 3:197612523-197612545 TCCAGGGAAGTGGGGTGGATGGG + Intergenic
968813490 4:2810341-2810363 ACCAGGGCTGTGGGGGGAATGGG + Intronic
968978947 4:3836436-3836458 CTCAGGGAGGTTGGGGGAAACGG - Intergenic
969615381 4:8249267-8249289 TCCAGGGAAATGGGGCCAATAGG + Intergenic
970609875 4:17714980-17715002 TGCAGGGAGGTGAGGGGAAGGGG - Intronic
970860646 4:20699073-20699095 TCCAGGGAGGAGGGGTTAAAAGG + Intronic
971176917 4:24291024-24291046 ACCAGAGAGGAGGGGTGAATGGG - Intergenic
971409737 4:26357731-26357753 ACCAGGGACCTGGGGGCAATGGG - Intronic
972109594 4:35541343-35541365 TCCAGGGAGGCCTGGGGGATTGG - Intergenic
973774754 4:54233021-54233043 TCCGGGCGGGTGGGGGGAAAGGG - Intronic
974706970 4:65531353-65531375 TCCAGGGAGGAAGGAGGAAAGGG - Intronic
976239918 4:82944195-82944217 TCCAGGGAGAGTGGAGGAATGGG - Intronic
976798635 4:88962543-88962565 TCCAGAGTGGTGGGAGCAATGGG + Intronic
981253621 4:142634034-142634056 AGGAGGGAGGTGGGGGGAAAAGG + Intronic
981364633 4:143888091-143888113 ACCATGGAGGTGGGGTGACTTGG + Intronic
981375132 4:144006376-144006398 ACCAAGGAGGTGGGGTGACTTGG + Intronic
981385748 4:144128565-144128587 ACCATGGAGGTGGGGTGACTTGG + Intronic
983109774 4:163735229-163735251 TCCAGGGAGATAGGTGGATTGGG - Intronic
983542839 4:168931276-168931298 TCCATGGAGGTAGGGGGCATTGG - Intronic
983679657 4:170338523-170338545 TGGAGGGAGGTAGGTGGAATGGG + Intergenic
983729920 4:170979786-170979808 GCCAGGGAAGTGGGGGAAAGCGG + Intergenic
984112958 4:175643100-175643122 GCAAGGGAGGTGGGAAGAATCGG - Intronic
984747124 4:183232416-183232438 AGGAGGGAGGTGTGGGGAATGGG - Intronic
984934037 4:184874289-184874311 TCCAGGCAGTTGGGGGACATTGG + Intergenic
985117441 4:186605564-186605586 TGGAGGGAGGGGGGAGGAATGGG + Intronic
985680290 5:1252639-1252661 TTCATGGAGGTGGGGGGCAGGGG - Intergenic
985962883 5:3316204-3316226 TCTAGGGAGAGGGGGGGAATTGG + Intergenic
986444677 5:7811077-7811099 TCCAGGTTGTTGGGGGAAATGGG - Intronic
987304036 5:16621252-16621274 TCAAAGGGGGTGGGGGGAAGAGG - Intergenic
988654841 5:33198647-33198669 GGCTGGGAGGTGGGAGGAATGGG - Intergenic
991212128 5:64118020-64118042 TCCAGGGAGGAGGTGGGAGATGG + Intergenic
991339501 5:65592642-65592664 TCCTGGGAAGTTGGGGCAATGGG - Intronic
991686461 5:69186833-69186855 TCTCGGGGGGTGGGGGGAAAGGG - Intergenic
992389865 5:76320633-76320655 TCCATGGAGGTGGGGGAGGTGGG + Intronic
992778779 5:80109951-80109973 TCCAGGAATGTGTGGGGTATGGG - Intergenic
993165067 5:84342408-84342430 CTCAGAAAGGTGGGGGGAATGGG + Intronic
994060491 5:95471607-95471629 GCCTGGGAGCTGAGGGGAATTGG - Intronic
995267904 5:110186274-110186296 TGTAGGGGGGTGGGGGGCATGGG - Intergenic
997301277 5:132807483-132807505 TCCAGGGACTTGAGGGGGATGGG - Intergenic
997365188 5:133321135-133321157 ACAAGAGAGGTGGGGGGTATGGG + Intronic
997582228 5:135025237-135025259 GCCAGGTAGGTGGCAGGAATTGG + Intergenic
998038815 5:138937917-138937939 TCCTGGGAGGAGGGTGGAAGAGG - Intergenic
998608227 5:143659052-143659074 TTTGGGGAGGTGAGGGGAATGGG - Intergenic
999190811 5:149745857-149745879 TCATAGGAGGTGGGGGGATTAGG + Intronic
999306730 5:150524383-150524405 TCCTGGAGGGTGGTGGGAATAGG + Intronic
999710450 5:154313831-154313853 TCGAGGGAGGATGGGGGAAAGGG + Intronic
1000171061 5:158703786-158703808 GCCAGGGAGATGGGGGCAAGGGG - Intronic
1000395680 5:160772514-160772536 TCCAGGGATGTGGGGGCATGAGG + Intronic
1000821034 5:165983542-165983564 ACCAGGGACTTGGTGGGAATGGG - Intergenic
1001932849 5:175685497-175685519 TCCTGGCATGTGGTGGGAATTGG - Exonic
1002359720 5:178661031-178661053 TCCAGGAAGGTGGTGGCCATGGG - Intergenic
1002561342 5:180084249-180084271 TCCAGGGAGGGGTGGGGAGCTGG + Intergenic
1002624887 5:180519134-180519156 TCCAGAGAGGTTGGGGTAAGAGG + Intronic
1003071337 6:2947778-2947800 TGCATGGAGGTGGGGGGAGCAGG - Intergenic
1003099406 6:3165472-3165494 TCCAGGGAGGTTAGGGGATGGGG + Intergenic
1003120473 6:3315263-3315285 TGCAGGGAGGTCGGGGGAGCAGG + Intronic
1005048692 6:21665211-21665233 AGCAGGGAGGTGGGGGAAATGGG - Intergenic
1006345732 6:33480894-33480916 TTCAGGGAGGGGGAGGAAATGGG - Intergenic
1007169173 6:39850352-39850374 GCCTGGGAGGTGGGGGGTAAAGG - Intronic
1008506582 6:52236827-52236849 TCCTGTGAAGTGGAGGGAATTGG + Exonic
1009340061 6:62542352-62542374 TCAAGGGATGTGAGAGGAATGGG - Intergenic
1011099782 6:83708704-83708726 TCCAGGGCGGGCGGGGGACTGGG - Intronic
1011410180 6:87059633-87059655 GCCAGGGAGGTGGGGGGAGGGGG + Intergenic
1012053214 6:94370537-94370559 TCTAGGGATGTGGAGGGAGTGGG + Intergenic
1013130222 6:107225566-107225588 TACAAGGAGGTGGGGCTAATTGG + Intronic
1014689651 6:124547878-124547900 TGTAGGGTGGTGGGGGGAAGAGG - Intronic
1015305000 6:131697418-131697440 TCCAGGGTGGGGGCGGGAAGGGG + Intronic
1015465418 6:133543352-133543374 CAGAGGGAGGTGGTGGGAATGGG + Intergenic
1015476985 6:133665547-133665569 GGGAGGGAGGTGGGGGGATTCGG + Intergenic
1015720471 6:136235950-136235972 TCCAAGGAGGTGGGGACCATAGG + Intronic
1016172964 6:141041925-141041947 TACAGGGAGGTGTGGAGGATGGG - Intergenic
1016383149 6:143506145-143506167 TCCAGGGATGGGATGGGAATAGG - Intronic
1016783651 6:147987317-147987339 TAAAAGGAGGTGGGGGGAGTGGG + Intergenic
1017084992 6:150705520-150705542 TCCTGGCAGGTGGGGCGACTGGG - Intronic
1018878994 6:167856362-167856384 TCCAGTGGGGTGGGGGGTCTTGG + Intronic
1018957706 6:168421492-168421514 GCCAGGGCGCTGGGGGGACTAGG - Intergenic
1018975604 6:168562943-168562965 TCCAGTGAGATGGAGGGAACAGG - Intronic
1019121970 6:169811165-169811187 TCCAGGGAACTTGGGGGAAGAGG + Intergenic
1019295462 7:271866-271888 GCCTGGGAGGAGAGGGGAATGGG - Intergenic
1019347634 7:538568-538590 CCCAGAAAGGTGGGGGGAAGGGG + Intergenic
1019356847 7:584739-584761 AGGAGGGAGGTGGGGGGCATAGG - Intronic
1019604117 7:1899969-1899991 TCCTGGGAGATGGGGTGAAGGGG - Intronic
1019714534 7:2532353-2532375 TTCAGGGAGGAGTGGGGCATCGG - Intergenic
1019742647 7:2682460-2682482 TCCAGGGAGGCCTGGGGAAACGG + Intronic
1019746261 7:2701900-2701922 AGCAGGGAGGTGGAGGGAAGCGG - Intronic
1020217074 7:6201356-6201378 TCCAAGGAGGTGGCGAGAATCGG - Intronic
1020484955 7:8710314-8710336 TCCAGGCAGCTGGGGCAAATGGG + Intronic
1021635008 7:22683492-22683514 TCCAGGGAAGTGGAAGGAACTGG + Intergenic
1022570674 7:31450355-31450377 TCCAGGGAAGAGGGGGGAAGTGG - Intergenic
1023395734 7:39750204-39750226 TCCAGAGAGATGGGCGGATTGGG - Intergenic
1024668250 7:51566611-51566633 TCAAGGTAGGTGGCAGGAATGGG + Intergenic
1025211161 7:57020302-57020324 TGCAGGGAGCTGGGCGGATTAGG - Intergenic
1025660794 7:63556545-63556567 TGCAGGGAGCTGGGCGGATTAGG + Intergenic
1025686583 7:63723425-63723447 CCAAGGCAGGTGGGGGGAGTAGG - Intergenic
1026585304 7:71651242-71651264 GGAAGGGAGGTGGGGAGAATAGG + Intronic
1026933386 7:74237809-74237831 TCCGGGGTGGAGGTGGGAATTGG - Intronic
1028261663 7:88674086-88674108 GCCAGGGAAGTGGGGGAAAGTGG - Intergenic
1028467904 7:91173348-91173370 TCTAGGGAGGTTGGAGCAATGGG + Intronic
1029161047 7:98552121-98552143 TCCAGGGAGGGGAGGGGGATTGG + Intergenic
1029494427 7:100889495-100889517 TCCAGGGCGGTGGGCGGGAGCGG + Exonic
1029706893 7:102280872-102280894 TCCAGGGAGGGGGTGGGTAGGGG - Intronic
1030147462 7:106371230-106371252 TCTGAGGAGGTAGGGGGAATTGG - Intergenic
1030219436 7:107081617-107081639 TCCGGGGAGGTGCAGGGAAGGGG - Intronic
1030690136 7:112523967-112523989 TCCTGGGAGGTAGGGGCAAATGG + Intergenic
1031190666 7:118545479-118545501 TGTAGTGAGGTGGGGGGAATAGG + Intergenic
1031506640 7:122592833-122592855 TCCAGGGGGATGGGGGGAGGGGG + Intronic
1031712089 7:125061303-125061325 GCCAGGGAGGTGGAGGGCAAGGG - Intergenic
1031870009 7:127081195-127081217 TGGAGGCAGGTGGGGGAAATGGG - Intronic
1032089458 7:128904011-128904033 TCCAGGGAGGTGCAGGGCCTGGG + Intronic
1033486477 7:141794165-141794187 GCCTGGGACGTGGGGGAAATAGG + Intergenic
1033489854 7:141832862-141832884 TTAATGGAGGTGGGGGGAAGGGG - Intergenic
1034051722 7:147990888-147990910 TCCAGGGAGGAGGGGAAAAGGGG - Intronic
1034232157 7:149538947-149538969 TCCCTGGAGGTAGGGGGATTGGG + Intergenic
1034374508 7:150630470-150630492 TTCTGGGAGGTGGGGGGAGGTGG + Intronic
1034624023 7:152478720-152478742 TCAGGGGAGGTGGGGGGACAGGG + Intergenic
1034882415 7:154772596-154772618 ACCGGGGAGTTGGGTGGAATGGG + Intronic
1035160248 7:156944757-156944779 TCCAGGGAGCTGGGGGTGTTTGG - Intergenic
1035318983 7:158016191-158016213 ACAAGGGAGGTGGGGAGGATGGG + Intronic
1035471089 7:159109343-159109365 GGCAGGGAGGTTGGGGGAGTGGG + Intronic
1035898820 8:3435372-3435394 TCCAGAGAGGTGGCGGGACTGGG - Intronic
1035992882 8:4511558-4511580 TTCAGAGAGGTGGGGGTCATAGG + Intronic
1036917660 8:12820331-12820353 TTCTGGGAGGTGGGGGGTTTTGG - Intergenic
1037632293 8:20669186-20669208 TCCAGGCAGGTGAGGGGAGTAGG - Intergenic
1037816412 8:22115003-22115025 TCCAGGGAGGGAGGGGGACATGG - Exonic
1037891226 8:22624664-22624686 TCCAGGGAGCTGGGTGGCACAGG + Intronic
1037904142 8:22705405-22705427 TTCATGGAGGAGGGGGGACTGGG - Intergenic
1038416114 8:27397256-27397278 GCCAGGGTGGAGGGAGGAATGGG + Intronic
1038981625 8:32765775-32765797 TTAAAGGAGGTGGGGGAAATGGG - Intergenic
1039420269 8:37431999-37432021 TCCAGGCTGGTGGTGGGCATGGG - Intergenic
1039458977 8:37727577-37727599 TTCAGGGAGTTGGGGGGAGGTGG - Intergenic
1039472271 8:37820911-37820933 TCCAGAGAGGTTGGGGGTAGGGG + Intronic
1039475826 8:37838971-37838993 CCCAGGGAGGTGGGGGGCGCCGG + Exonic
1039718630 8:40138365-40138387 TGCTGGGAGGTGGGGGGAGGGGG - Intergenic
1040890108 8:52308664-52308686 TCCAGGGAGGTGAGTGGGTTTGG + Intronic
1040983062 8:53265832-53265854 TCCAGGGAGCTGGGGGAGACAGG - Intergenic
1041304716 8:56447055-56447077 CCCAGGGAGGAGGCGGGAAAGGG - Intergenic
1041428270 8:57748266-57748288 TGCTGGGAGTTTGGGGGAATGGG - Intergenic
1042224629 8:66505546-66505568 CCCAGGGAGGTGCGGGGAGCTGG - Intronic
1042928280 8:73989101-73989123 CCAAGGGAGGAGGGGGAAATGGG - Intergenic
1045505973 8:102779015-102779037 CCCTGGGAGGAGAGGGGAATGGG + Intergenic
1047419573 8:124695938-124695960 TCCCGGGAGGGGCGGGGAAGTGG + Intronic
1047611332 8:126523670-126523692 TCTGGGGAGTTGGGGGGAAATGG - Intergenic
1047954208 8:129961031-129961053 TCCAGGTAGGTCTGGGGAGTAGG - Intronic
1048302495 8:133261720-133261742 TGCAGGAAGGCTGGGGGAATGGG + Intronic
1048941528 8:139404480-139404502 TCCAGGGAGCCGGGGAGAAATGG + Intergenic
1049230327 8:141478456-141478478 TCCAGGGTGGGGTGGGGCATGGG + Intergenic
1049272069 8:141701170-141701192 TCCAGGGCGGAGGGAGGAAGGGG + Intergenic
1049509329 8:143019518-143019540 TTTAGGGGGGTGGGGGGAAAAGG + Intronic
1049698044 8:143993245-143993267 TCCAGGGGGGTGGGGGGGAGGGG - Exonic
1049708934 8:144055065-144055087 CACAGGGATGTGGGGGGCATTGG + Exonic
1049826976 8:144675104-144675126 TCCATGGAGCTGGTGGGAACTGG - Intergenic
1049988520 9:972633-972655 TCCAGGACGGTGTGGGGAAGCGG + Intergenic
1050457842 9:5850469-5850491 TCTGGGGTGGTTGGGGGAATTGG + Intergenic
1050484855 9:6123371-6123393 TCCGGAGAGGTGGTGGGAGTGGG + Intergenic
1050691680 9:8234386-8234408 ACCAGGGAGGTGTGGGTGATGGG + Intergenic
1050963935 9:11772188-11772210 TGTAGGGGGGTGGGGGGAAAGGG + Intergenic
1051324216 9:15947352-15947374 TCTAGGGAGATGGGGGAAATGGG - Intronic
1051411928 9:16798733-16798755 TACAGGGTGGTGGGGAGCATAGG - Intronic
1052494600 9:29211887-29211909 TCAAGGGAGGCGGGGGAAATTGG + Intergenic
1052501607 9:29298729-29298751 TCTGAGGAGGTGGGGGGAAGTGG + Intergenic
1054718985 9:68584873-68584895 TGGCGGGAGGTGGGGGGATTGGG + Intergenic
1054923257 9:70562917-70562939 TCCAGGGAGGGGAGAGAAATTGG - Intronic
1057199245 9:93131591-93131613 GGCAGGGAGGTGGTGGGGATGGG - Intronic
1057199691 9:93133585-93133607 TCAAGGCAGGTGAGTGGAATAGG + Intronic
1057311904 9:93948220-93948242 TCCAGGGAGATGGGGAGAGATGG + Intergenic
1057686190 9:97237324-97237346 TCCAGGGATGGGGGCAGAATGGG - Intergenic
1058432071 9:104928353-104928375 TCTAGGGAGTTGGGGGGAGGTGG + Intergenic
1058541004 9:106012658-106012680 TCTAGGGAGGAGGGGGGAAGAGG - Intergenic
1059282822 9:113149445-113149467 TCAATGCAGGTGGGGGGAGTGGG + Intergenic
1059354856 9:113690784-113690806 TTCAGGGAGATGAGGGGAAGGGG - Intergenic
1059530805 9:115033764-115033786 TCCATGAAGATGAGGGGAATGGG + Intronic
1059747382 9:117216308-117216330 TCCACAGAGGTAGGGGGACTGGG + Intronic
1060513627 9:124251894-124251916 TTCAGGGAGGTGCGGGGAGGTGG + Intergenic
1061063479 9:128262957-128262979 TGCTGGGAGGTGGGGGGTACAGG - Intronic
1061203116 9:129148473-129148495 TTCAGGGAGGTGGGAGGACAAGG - Exonic
1061246354 9:129402885-129402907 AACAGGGTGGGGGGGGGAATCGG + Intergenic
1061382430 9:130266320-130266342 TCCAGGGGGGTGGGAGGGAAGGG - Intergenic
1061394407 9:130335912-130335934 TCCATGGAGGAGGTAGGAATTGG - Intronic
1061802958 9:133121992-133122014 GCCAGGGAGGTGGGGGAGAGCGG + Intronic
1062109780 9:134775811-134775833 ACCAGGGAGGTGAGGGGCAGGGG - Intronic
1062262479 9:135669901-135669923 TCCAGGCAGGTGTGGGAGATGGG - Intergenic
1062540808 9:137040891-137040913 CCCAGGGAGGTGTGGGGCGTGGG + Exonic
1062732093 9:138115750-138115772 GCCAGGGAGGTTGAGGAAATGGG - Intronic
1203703290 Un_KI270742v1:13736-13758 TCCGGGGGGGGGGGGGGAAGAGG - Intergenic
1203621310 Un_KI270749v1:131222-131244 TCCAGGGAGGCGGGGCGGTTTGG + Intergenic
1185603944 X:1356355-1356377 TCCACGGGGGTGGGGGGGCTGGG - Intronic
1186517205 X:10174828-10174850 GGCAGGGAGGTGAGGGGACTGGG - Intronic
1187257730 X:17657065-17657087 GCCAGAGAGGTGGGGGCGATGGG - Intronic
1189427715 X:40916426-40916448 TTTAGGGAGGTGAGGGGAAATGG - Intergenic
1190264304 X:48818195-48818217 GCCAGGGAGGGGGTGGGAAGCGG - Intronic
1191627020 X:63280633-63280655 TCCATGGAAGTTGGGGGAACAGG - Intergenic
1192177910 X:68897436-68897458 TCCAGGGTGCTGGTGGGGATGGG - Intergenic
1192181567 X:68919115-68919137 TACAGGGTGGTGGGGGGAGGGGG + Intergenic
1192354751 X:70390773-70390795 GCCAGGGTTGTGGGAGGAATTGG - Intronic
1192577539 X:72255051-72255073 TCCGGGGAGGTGGGAGGAGTCGG + Intronic
1195112132 X:101659196-101659218 TCACGGGAGGTGGGGGGGAGGGG - Intronic
1196531210 X:116788830-116788852 TTCAGGGACATGGGGGGAAAGGG + Intergenic
1197249546 X:124200668-124200690 TACAGGGAAGTGGGGGAATTGGG - Intronic
1197335329 X:125204477-125204499 TGGAGGGAGGTGGGGGGAGGAGG + Intergenic
1197763893 X:130046902-130046924 GGCAGGGAGGAAGGGGGAATGGG - Intronic
1197783612 X:130179473-130179495 TCCTGGGGGGTGGGGGGAGTGGG + Intronic
1198037978 X:132820601-132820623 TCCAGGGAGCTGTGGGCAAAAGG + Intronic
1198581028 X:138064451-138064473 TCCAGTGAGGTGGGTGGAAGTGG + Intergenic
1198686090 X:139229440-139229462 TCCAGGTGGGAGGTGGGAATGGG - Intergenic
1198807985 X:140508115-140508137 TCTAGGAAGGGCGGGGGAATGGG - Intergenic
1200074281 X:153543546-153543568 GCCAGGGAGGTGGGGGTCAGAGG + Intronic
1200659093 Y:5939833-5939855 TTGAGGCAGGTTGGGGGAATGGG + Intergenic
1202378332 Y:24257357-24257379 TCAGGGGAGGTGGAGGGAACTGG - Intergenic
1202492450 Y:25412764-25412786 TCAGGGGAGGTGGAGGGAACTGG + Intergenic