ID: 1088353826

View in Genome Browser
Species Human (GRCh38)
Location 11:108920867-108920889
Sequence ACTAAAAATGTCTTCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 6, 2: 33, 3: 99, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088353825_1088353826 -5 Left 1088353825 11:108920849-108920871 CCACTAGCATTTGGGACAACTAA 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG 0: 1
1: 6
2: 33
3: 99
4: 383
1088353824_1088353826 1 Left 1088353824 11:108920843-108920865 CCTCTACCACTAGCATTTGGGAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG 0: 1
1: 6
2: 33
3: 99
4: 383
1088353821_1088353826 7 Left 1088353821 11:108920837-108920859 CCTTGGCCTCTACCACTAGCATT 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG 0: 1
1: 6
2: 33
3: 99
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088353826 Original CRISPR ACTAAAAATGTCTTCAGACA TGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901008689 1:6185208-6185230 ACTAAAAATGACTTACTACATGG + Exonic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902284797 1:15400547-15400569 ACTAAAATTATGTCCAGACATGG - Intergenic
902675285 1:18004503-18004525 ACTGCAAATGTCTGCTGACAGGG - Intergenic
902904432 1:19544862-19544884 GCTGAAAATGTCTTCACAGATGG + Intergenic
903290903 1:22313626-22313648 GCTATAAATGTCTTCATAGAAGG - Intergenic
904628139 1:31820254-31820276 ACCAAAAATTTAGTCAGACATGG - Intergenic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906970022 1:50503007-50503029 ATTAAAAATGTTTTTAGAGATGG + Intronic
907211502 1:52827693-52827715 ATTAAAAATGTCTGCAGGCTGGG - Intergenic
907514480 1:54984765-54984787 AGTTAAAGTGTCTTCAGAGAAGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
910977239 1:92919686-92919708 AGTAAAAATTTATCCAGACAAGG + Intronic
911354588 1:96800434-96800456 ACTAAAAAGGGCTTTAGACCAGG + Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
914424618 1:147563713-147563735 TCCAAAAATGACTTCAGACGTGG - Intronic
914561302 1:148822176-148822198 ATTAAGAATATCTTCACACAGGG + Intronic
914611532 1:149308032-149308054 ATTAAGAATATCTTCACACAGGG - Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916703288 1:167320346-167320368 GCTGAAAATGTCTTCACAGATGG - Intronic
917713871 1:177713847-177713869 AGCATAAGTGTCTTCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
919598221 1:199590865-199590887 ACTAAAATAGTCTTCTAACAGGG - Intergenic
920407039 1:205722808-205722830 ACTAGAAGTGTTTTCAGAAAAGG - Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
922022357 1:221717547-221717569 ACAAAAAATGCATTCAGAAAAGG - Intronic
923548144 1:234939908-234939930 ACTAAGAATGCCTTCCCACAAGG + Intergenic
1062840082 10:663401-663423 ACTAAAAGTGTCTTTAAAAAGGG + Intronic
1064167274 10:12997317-12997339 CCTAAAAATGTCTTCAATCGGGG + Intronic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1067795126 10:49315603-49315625 TCTAAAAATGTCTTGGGCCATGG + Intronic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1070233579 10:74598388-74598410 ACAAAATATGTCTTCTCACAGGG + Intronic
1070889545 10:79932345-79932367 TCTAAGAATGTTATCAGACAGGG - Intergenic
1072249359 10:93569368-93569390 ACTAAAATTGTGTGCTGACAGGG + Intronic
1072355567 10:94606520-94606542 AAAAAAAATTTCTTGAGACAGGG + Intronic
1072413447 10:95227274-95227296 ATTAAAAATGTTTTCATATAAGG - Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1072887147 10:99287869-99287891 ACTAAAAATGGCTTCTGGTAGGG + Intergenic
1073741145 10:106408563-106408585 ACAAAAAATTTTTTCAGAGATGG + Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074228194 10:111508025-111508047 ACTAATAATGTCTTCAGAGATGG - Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078350670 11:10590539-10590561 ACTAAAGCTGTCTTGAGGCAAGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078708870 11:13770874-13770896 ACTAAAACTGTCCTAAGAAAGGG - Intergenic
1079352702 11:19705416-19705438 ATTAAGAATGTCTTCTAACAAGG - Intronic
1080322799 11:31033843-31033865 AGTAAAAATGTCTACAGGCCGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1081933844 11:46890917-46890939 AGTTTAAATGTCTTTAGACAGGG + Intronic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084199784 11:67548553-67548575 ACTAGAAATCTCTTGAGAGAAGG + Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084752300 11:71212377-71212399 CCTAAAAATGTTCTCAGACCTGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085353966 11:75818986-75819008 ATCAAAAATGAGTTCAGACATGG + Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089249800 11:117150022-117150044 AATAAAAATTTTTTGAGACAAGG - Intronic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090071294 11:123546778-123546800 ACTACAAATGTCAGCATACAGGG + Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092623569 12:10301230-10301252 AAGAAAAAAGTCTTCTGACAAGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095706624 12:45243843-45243865 ACTAAAAATTTATTCAGGCTGGG - Intronic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1097204469 12:57308349-57308371 TTTAAAAATGTCTTCAGGCCGGG - Intronic
1097831752 12:64232412-64232434 TCTAAAATTGTCTTCAGTGAGGG + Intergenic
1097966758 12:65589993-65590015 ACTACAAATGGCCTCAGACATGG - Intergenic
1098740222 12:74164768-74164790 ACTGAAAATGTCCAAAGACAGGG + Intergenic
1100772989 12:97944028-97944050 CCTTAAAATGTGATCAGACAGGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102624291 12:114222205-114222227 ACTAAGAATATCTCCACACATGG - Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105626373 13:22117061-22117083 AATAAAAATGGCTTAAGTCAGGG + Intergenic
1105666369 13:22561707-22561729 TATAAAAATGTCCTCAGCCATGG + Intergenic
1106053366 13:26213071-26213093 ACTGAAAAAGTATTCAGAAATGG - Exonic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108724628 13:53166508-53166530 TCTAAAAATGTCCACAGCCATGG - Intergenic
1108780544 13:53825801-53825823 AATAAATATGTCTAGAGACAAGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109718624 13:66248434-66248456 ATAATAAATGTCTTCAGAAAAGG - Intergenic
1109847079 13:68007735-68007757 ACAAAAAATGTTTTCAGCCATGG + Intergenic
1112086494 13:96037511-96037533 ACTATAAATTTCTTTATACAGGG + Intronic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1114608112 14:24014848-24014870 ATTAAAATTCTCTTAAGACAGGG - Intergenic
1116266218 14:42693978-42694000 ACTAAAAAGTTCTTAAGATATGG + Intergenic
1116304530 14:43233754-43233776 TCTAAAAATGATTTCAGACCGGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116832610 14:49737137-49737159 ACAAAAAATGCCCTCATACATGG - Intronic
1118069123 14:62225877-62225899 CATAAAAATGTCTTCAAACTCGG + Intergenic
1118972324 14:70647513-70647535 ACTAGAAATGGCTTCAAACATGG - Intronic
1119004876 14:70915422-70915444 ACTAAAATGTTCTACAGACAGGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1121977460 14:98418873-98418895 ACTATAAATATCTTGAGAGAAGG + Intergenic
1126863797 15:52914925-52914947 ATTAAAAATGACATCTGACAAGG + Intergenic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1128794635 15:70456340-70456362 ACTAAAATTTTCTGCAGAAATGG - Intergenic
1129185495 15:73903581-73903603 ACTAAACAGGCCTTCTGACAAGG - Intergenic
1129620939 15:77145151-77145173 CTTAAAAATGTCTTCAGGCCAGG + Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130044464 15:80432959-80432981 AGTAAAAATGTTTACACACAAGG - Intronic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130519704 15:84653183-84653205 ACAAAAAAAGTCTTCAGGCTGGG - Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131037864 15:89236502-89236524 GCTGAAAATGTCTTCACAGATGG - Intergenic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134161998 16:11898861-11898883 ATTAAAAATATCTGCAGAAAAGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134750630 16:16622259-16622281 AATAGAAATGTCTTCAGAATTGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1134994825 16:18731327-18731349 AATAGAAATGTCTTCAGAATTGG - Intergenic
1135060350 16:19266292-19266314 ACCCCAAATGTCTTCGGACATGG - Intronic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135129978 16:19845436-19845458 AATAAAAAAGTCATAAGACACGG + Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135657864 16:24267292-24267314 TCTAAAATTGTTTTGAGACAGGG + Intronic
1136492589 16:30619207-30619229 ACAAACAATGTCGTCAGACACGG + Intronic
1137647145 16:50085625-50085647 ATTATAATTTTCTTCAGACAGGG - Intronic
1138058669 16:53864089-53864111 TCTGAAAATGTTTTCAGCCATGG + Intronic
1139060649 16:63246637-63246659 ACTAAAAATGTCTTCTTACTGGG + Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140183626 16:72746463-72746485 GCTAAAAATGAATTCTGACAAGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140635513 16:76908360-76908382 ACTAAAGTTTTCTTGAGACAGGG - Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1144108011 17:12003625-12003647 CCGTAAAATGTCTTTAGACAAGG + Intergenic
1144407231 17:14963942-14963964 AAAAAAAATGTTTTCAGATAAGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148639262 17:49173434-49173456 GCTGAAAATGTCTTCACAGATGG - Intergenic
1149883875 17:60320755-60320777 AATAAAAATATTTTCAGAAAGGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150781961 17:68130990-68131012 AATAAAAATTGATTCAGACAAGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152764761 17:82130188-82130210 AAAAAAAATGTTTTGAGACAGGG - Intronic
1154970124 18:21399631-21399653 ACTTAAAATATATTCAGAGATGG - Intronic
1155634144 18:27931907-27931929 AATAAATATGTCATCTGACAAGG - Intergenic
1156318629 18:35995956-35995978 ACTATCAAGGTCATCAGACAAGG + Intronic
1156396165 18:36701900-36701922 ACTGAAGATGACTTCAGAGATGG - Intronic
1156431723 18:37081985-37082007 AGTAAATATGTGCTCAGACAAGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158445295 18:57515256-57515278 ACAAAAAATTTTTTGAGACAAGG + Intergenic
1159309958 18:66694431-66694453 ACTAAAAAAATCTCCAGAAATGG - Intergenic
1160476896 18:79199408-79199430 ACTAAAAAAGACTACAGACTAGG - Intronic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162136265 19:8557301-8557323 ACAAAAAAAGTTTTGAGACAGGG + Intronic
1162642769 19:12025064-12025086 ACTGAAAATGTCTTCACAGATGG + Intronic
1163398742 19:17079082-17079104 ACTGAAAATGACTCCAGCCATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164394637 19:27851941-27851963 CCTTAAAATGACCTCAGACACGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166657807 19:44624922-44624944 ACTAAAAATTTAATCAGGCATGG + Intronic
1168361204 19:55742271-55742293 ACAATAAATTTCTTGAGACAAGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
926577338 2:14596676-14596698 ATTAAACATGGCTTCAGACTTGG + Intergenic
926794803 2:16610380-16610402 ACAGAAAATGGCTTAAGACATGG + Intronic
927262006 2:21101438-21101460 AATCAAAATGTCTCAAGACATGG - Intergenic
927664597 2:25021798-25021820 ACTAAAAATATGTACAAACATGG - Intergenic
928591346 2:32818775-32818797 AGTAAAAAGGTATTCAGAAATGG - Intronic
928902918 2:36340417-36340439 CAAAAGAATGTCTTCAGACATGG + Intergenic
929296715 2:40256692-40256714 AAAAAAAATGTCTTTAGAGAAGG + Intronic
929494359 2:42427306-42427328 AATAAAAATGTTTCCTGACAGGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929656916 2:43742295-43742317 AAAAAAAATGTCTTCAGGCCAGG - Intronic
930062954 2:47305998-47306020 ACAAAAAATTTCTTCAGGCCAGG + Intergenic
930159973 2:48144838-48144860 ACTAAACCTGTCTTCAACCAAGG - Intergenic
930535530 2:52641427-52641449 ACTAAAAATGCCTTCAGCTTTGG + Intergenic
931119937 2:59205236-59205258 AAAAAAAAATTCTTCAGACAAGG + Intergenic
931542304 2:63342509-63342531 ACTAAAAATATATACAGAAAAGG - Intronic
932578023 2:72973369-72973391 ACTGAAAATGCCCTCAAACATGG - Intronic
932602900 2:73141930-73141952 AATAAAAATATTTTCAGGCAGGG - Intronic
933086368 2:78059053-78059075 ACTAAACATATCTTCAACCAGGG - Intergenic
933680102 2:85092155-85092177 ACAAAAAAGGGTTTCAGACATGG + Intergenic
933919566 2:87031067-87031089 ACTAAAAATATCTTCCCTCATGG - Intergenic
933932067 2:87162739-87162761 ACTAAAAATATCTTCCCTCATGG + Intergenic
934003428 2:87738835-87738857 ACTAAAAATATCTTCCCTCATGG + Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
935915493 2:107945178-107945200 ACTGAGAATGTCTTCACAGATGG - Intergenic
935924377 2:108051650-108051672 ACTAAGGAGGGCTTCAGACAGGG - Intergenic
936361049 2:111802695-111802717 ACTAAAAATATCTTCCCTCATGG - Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937845855 2:126578107-126578129 AATAAAGATATTTTCAGACACGG + Intergenic
938606650 2:132900403-132900425 AATAAAGATGTCTCTAGACATGG + Intronic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
942696630 2:178653946-178653968 ACTAAAATTGTTTTCAGGAATGG + Intronic
942697069 2:178658206-178658228 ACTAAAATTGTTTTCAGGAATGG + Intronic
942697509 2:178662467-178662489 ACTAAAATTGTTTTCAGGAATGG + Intronic
942704070 2:178748210-178748232 ACTATAGATTTCTTCAGAAAAGG + Intronic
943222637 2:185130633-185130655 AATAAAAATGTTTTCAAATAAGG + Intergenic
943785844 2:191877811-191877833 ACAAAAGATGTCTTTAGGCATGG - Intergenic
945338218 2:208618020-208618042 ACTAAAAATATCTACAACCAAGG - Intronic
945340518 2:208647367-208647389 AGTAAAACAGTCTTCAGAAAAGG + Intronic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175115223 20:56677271-56677293 ATTAAAAATTTTTTGAGACAGGG + Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175417088 20:58808900-58808922 ACTGAACGTGTCTACAGACAAGG - Intergenic
1176359676 21:5984089-5984111 ATTAAAAATGTTTTGAGACCAGG - Intergenic
1176789545 21:13303453-13303475 ACTCAAAATGACTTTAGACTTGG - Intergenic
1177988709 21:28011663-28011685 ACTCAAAATGACTTTAGACTTGG - Intergenic
1178171226 21:30041768-30041790 ACACAAAATGACTTAAGACATGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179146242 21:38770425-38770447 TTTAAAAGTGTCTTCTGACATGG + Intergenic
1179763842 21:43554461-43554483 ATTAAAAATGTTTTGAGACCAGG + Intronic
1180589416 22:16923719-16923741 ACTAAAAAAATCTGCAGCCATGG - Intergenic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1180896366 22:19336596-19336618 ACTAAACATATCTACAAACAAGG + Intronic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181337458 22:22149947-22149969 AATAAAAATTTTTTGAGACATGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182365078 22:29773183-29773205 ACTGAAAATGTCTTAAGCAAGGG + Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183564318 22:38602321-38602343 ACTAGAAATGTCTTCAGAGCTGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184269013 22:43367061-43367083 ACTACAAATGTGTTTACACATGG + Intergenic
949168245 3:966668-966690 ACTAAAAATTAGTTCAAACAAGG - Intergenic
949783459 3:7715315-7715337 AATAAAAATTTAGTCAGACATGG + Intronic
951284160 3:20788891-20788913 ACCGAAAAGGTCTTCAAACATGG + Intergenic
951408055 3:22325864-22325886 ACTACAAATGTCTTAAGAGGTGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952159921 3:30683124-30683146 ATTGAAAAGGTCTTCAGAGACGG - Intronic
952221740 3:31330346-31330368 AGTAAAAATGTCTTCAAATTTGG + Intergenic
953000704 3:38930760-38930782 GTTAAAAATGTCTTCATACAAGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953806072 3:46068301-46068323 ACCAAAAATGCTTTCAGACGTGG - Intergenic
954997830 3:54897765-54897787 ACTGAAAATATTTTCAGAAAGGG + Intronic
955506065 3:59634433-59634455 ATTTAAAATCTCTCCAGACATGG - Intergenic
955607609 3:60722630-60722652 CAACAAAATGTCTTCAGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
955946049 3:64194758-64194780 CTTAAGAATGTCTTCAGACCAGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956788065 3:72659182-72659204 ATTTATAATGTCTTCAGGCAAGG + Intergenic
956939646 3:74142967-74142989 ACTAAAAAATTATTCAGGCATGG - Intergenic
957220978 3:77381684-77381706 AAGAAAAATGACTTCAGGCAAGG + Intronic
957355142 3:79073738-79073760 AGCACAAATGTGTTCAGACAAGG - Intronic
957526615 3:81386353-81386375 ACCAAAATTGTGTTCAGAAAGGG + Intergenic
958547247 3:95569654-95569676 ACTAAAAATATATTAAGAGATGG + Intergenic
959443907 3:106413296-106413318 ACTAAAAATGTGTCAAGAGAGGG - Intergenic
960086315 3:113595275-113595297 ACTAAAAATGCCTCCAGGCTTGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960932457 3:122867684-122867706 AATAAAAATGTATTCAGGCTAGG + Intronic
961360276 3:126362845-126362867 ATTAAAGATGTTTTTAGACATGG - Intergenic
961859558 3:129904498-129904520 GCTGAAAATGTCTTCACAGATGG + Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962461367 3:135616445-135616467 ACTAAAACTTTCTCCAGACCAGG + Intergenic
962541862 3:136390651-136390673 ACTAAAAATTTGTTCCTACAAGG + Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
965314944 3:167179759-167179781 GCTGAAAATGTCTTCACAGATGG - Intergenic
966394388 3:179487140-179487162 ACTATGAATGTCTTTAGACTTGG + Intergenic
966976592 3:185089396-185089418 AGTAAAGAAGTCTTCAGTCAAGG - Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967685680 3:192412956-192412978 ACTCATAATGTCTTCAGAATAGG - Intronic
967750275 3:193106391-193106413 AATAAGAATCTATTCAGACAAGG - Intergenic
968161051 3:196427240-196427262 AGTAAAAATGTTTTGAGCCATGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970110438 4:12631481-12631503 ACCAAAAATGTTTTCAATCATGG - Intergenic
971621506 4:28859804-28859826 ACTTTCATTGTCTTCAGACAAGG - Intergenic
971696413 4:29910177-29910199 ACTAAAGATTTTTTAAGACATGG + Intergenic
973239634 4:47943841-47943863 ATGAAAAATGACTTCAGTCAGGG - Intronic
973268974 4:48241322-48241344 AGTAGAAATGTCTTGAGACTAGG + Intronic
974629652 4:64469033-64469055 TATAAAAATGTCTAAAGACATGG + Intergenic
974636195 4:64566820-64566842 ACTGAAAATGTCTTCACAGATGG + Intergenic
975692262 4:76977403-76977425 AATTAAAATGCCTTCAGAAATGG + Intronic
976155174 4:82136294-82136316 ATGAAAAATGCCTTTAGACATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976622015 4:87137947-87137969 CCTGGAAATGTCTTCAGTCAAGG - Exonic
978299672 4:107253020-107253042 AGATAAAATGTCTTCAGAGATGG + Intronic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
979161116 4:117462704-117462726 ATTTAAAATGTCTTCAGGCTGGG + Intergenic
980031284 4:127834862-127834884 ACTAAAAGTGACTTCAGAGCAGG - Exonic
980191849 4:129534512-129534534 ACTAAATAGGTCTTCAAACTAGG + Intergenic
980425811 4:132627091-132627113 TCTGAAAATGTCCTCAGGCATGG + Intergenic
980667450 4:135957774-135957796 GCTGAAAATGTCTTCACAGATGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984385699 4:179054506-179054528 ACCAAGATTGTCTTCAGAGAGGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984607506 4:181802278-181802300 TATATAAATGTCTTCAGCCAAGG + Intergenic
984820589 4:183878218-183878240 TCTAAAAATGTCTCCAGCAAGGG - Intronic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987164545 5:15181672-15181694 GCTAAAAATGTATTCAGACAAGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987459326 5:18189111-18189133 AATAAAAATGCCTTGAGACAAGG - Intergenic
987574304 5:19705949-19705971 GCTGAAAATGTCTTCACAGATGG + Intronic
988046750 5:25965791-25965813 AATAAAAATGTCTTCAGAATTGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989299777 5:39877188-39877210 ACATGAGATGTCTTCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990078491 5:51881893-51881915 TCTAAAAATATCTTAACACAGGG + Intergenic
990285084 5:54293285-54293307 ACAAAAACTGCCTTTAGACATGG - Intronic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
990756946 5:59083087-59083109 ACTAAAGATGTATTTAAACATGG - Intronic
991389480 5:66126867-66126889 ACTATAAATGTTTGCATACAGGG - Intergenic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
992832317 5:80606078-80606100 ACTAAAAATGTTTTCAGATTAGG - Intergenic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993682744 5:90899701-90899723 ACTAAAAATATATTCAAACAAGG - Intronic
993912719 5:93704072-93704094 ACTCAAAATGGCTTCAAAGAAGG + Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994814661 5:104569779-104569801 CCAAAGAATGCCTTCAGACAGGG - Intergenic
994874948 5:105409043-105409065 AGAAAAAAACTCTTCAGACATGG + Intergenic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
995455303 5:112345378-112345400 ATTAAATATGTGTTCAAACATGG - Intronic
996193441 5:120573729-120573751 ACTCAAAATGTCTGCAGCCATGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
999277562 5:150341516-150341538 TCTTAAATTGTCTTCAGAGAGGG + Intergenic
1000102733 5:158032189-158032211 ACTGAAAATGTCTTCAAATATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002407397 5:179046481-179046503 ATTAAAAAAGTAGTCAGACATGG - Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002787389 6:413430-413452 ACTAAAACCCTCTTCAGACTAGG + Intergenic
1003624893 6:7731942-7731964 ACTCAAATTGTGTTCAGAAAAGG + Intronic
1003650310 6:7953003-7953025 AGTAAAGATGTCTTTAAACATGG + Intronic
1003889216 6:10549050-10549072 ACCAAAAATGTCTTCACGCTGGG - Intronic
1004218792 6:13726883-13726905 ATTAAAAAATTCTTGAGACAGGG - Intergenic
1004338055 6:14782712-14782734 ACTAAAAATGTGTCCAGAATTGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008447731 6:51612399-51612421 CATAAAAATGGCTTCATACATGG - Intergenic
1008807963 6:55454679-55454701 ACTAAGAATGTTTGCAGACCAGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009274443 6:61657200-61657222 ACTGAAAATGTTTTTACACATGG + Intergenic
1009406350 6:63318198-63318220 ACAAAGAATTTCTTCAGACTGGG + Intronic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010002670 6:70963354-70963376 AGAAAAACTGTCTTGAGACAGGG - Intergenic
1010831108 6:80530675-80530697 ACTAAAATTGTTTTCAGAATCGG - Intergenic
1011669838 6:89672876-89672898 AGTAAAAATGTTTTAATACAAGG - Intronic
1011741002 6:90360578-90360600 TATAAACAAGTCTTCAGACAAGG + Intergenic
1012086373 6:94830683-94830705 ACTAAAACTGCATACAGACATGG + Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014204158 6:118637760-118637782 ACTAAAAATATTTGCAGATATGG + Intronic
1014635979 6:123847190-123847212 GATAAAAATGTCTTCAGAGATGG - Intronic
1014697932 6:124647249-124647271 ATTAAAAATGACTTCAGTCTGGG + Intronic
1016106419 6:140169781-140169803 AATAAAAATATTTTCAGATAAGG - Intergenic
1016720448 6:147290051-147290073 TTTAAAAATGTATCCAGACATGG + Intronic
1016966982 6:149728187-149728209 ACTAAATATGTCTTAAGAGCAGG + Intronic
1018572229 6:165223822-165223844 AAAAAATATGTCTTTAGACATGG + Intergenic
1019971371 7:4543580-4543602 AGTAAAACTGTCTAAAGACATGG + Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020966313 7:14873383-14873405 ACTGAAAACGTCTTAAAACATGG + Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024678938 7:51663127-51663149 ACAATACATTTCTTCAGACATGG - Intergenic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027524289 7:79247049-79247071 AGTAAAAATATCCTCAAACATGG + Intronic
1027551606 7:79604383-79604405 TTTAAAAATTTCTTGAGACAAGG + Intergenic
1027609273 7:80339081-80339103 ACTAAATATATCTTGAGCCAGGG + Intergenic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027657905 7:80954151-80954173 ACCAAAAATGTATTCGTACAGGG + Intergenic
1027750269 7:82135309-82135331 ACTAAACATCTCTTCAAAAATGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028104172 7:86857741-86857763 TCAAAATATGTTTTCAGACAAGG - Intronic
1028225580 7:88248704-88248726 TTTAAAAATTTCTTGAGACAGGG - Intergenic
1028686866 7:93600068-93600090 ACTATAATTGTCTTCAGAGCAGG + Intronic
1028891971 7:95998286-95998308 TCTAAAAATGTGGGCAGACATGG + Intronic
1029517109 7:101031496-101031518 ACTGAAAATGTGTTCAGATAAGG - Intronic
1029742476 7:102498842-102498864 ACTAAAAATGTATTCACAGCCGG + Intronic
1029760466 7:102598007-102598029 ACTAAAAATGTATTCACAGCCGG + Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030339040 7:108356739-108356761 GCTAAAATTGTCTTCTGACTTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031192832 7:118576598-118576620 ACTAACAATGTTCTCAGCCAGGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033885321 7:145937411-145937433 ACTTTAAATGGCTTCACACATGG - Intergenic
1034092670 7:148378494-148378516 GGTAAAAATGTCATCAGAAATGG - Intronic
1035691780 8:1563948-1563970 ATTTAAAAGGTCTTCAGACAGGG - Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036595499 8:10208359-10208381 ATTAAAAATGTTTTCAGCAAAGG + Intronic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1039208583 8:35185176-35185198 AACTAAAATGTCTTCAGTCAAGG + Intergenic
1039461034 8:37744508-37744530 ACTCAAAATGCCCTCAGACACGG - Intronic
1039721679 8:40170996-40171018 ACTAAGAATATCTTCTTACATGG + Intergenic
1040463270 8:47670372-47670394 ACTAAAAAAGACCTCAGACTTGG + Intronic
1040479517 8:47811336-47811358 AATAAAGATATCTTCAGAGAAGG + Intronic
1041019211 8:53621276-53621298 GGTAAAAATGTCTTCACAGATGG + Intergenic
1041687583 8:60658517-60658539 TCAAAATATGTCTTCAGCCAGGG - Intergenic
1042471420 8:69193193-69193215 ACTAAAACTGCACTCAGACAAGG - Intergenic
1043270241 8:78324180-78324202 ACTAACAATGTCTTTAGGGAAGG - Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046178606 8:110612078-110612100 AATGTCAATGTCTTCAGACATGG - Intergenic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1047048367 8:121080335-121080357 AATACAAATGTCTTTTGACATGG + Intergenic
1047137064 8:122091344-122091366 ACTACAAATGTCTTCTGTCACGG + Intergenic
1047646270 8:126873823-126873845 ACCAAAAAAGGCTTCAAACAAGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1047788099 8:128174075-128174097 ACAATAAATGTCTTAAGGCAGGG - Intergenic
1048569636 8:135640819-135640841 ACTAAAAATCTCTTCATTTATGG - Intronic
1048730035 8:137428457-137428479 TCTAATAATGTCTTCAGATGGGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050329428 9:4530681-4530703 AATAAAAATGTTTTCCGTCATGG - Intronic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051865191 9:21672585-21672607 ACTAAAAATGTTTGTAGGCAAGG + Intergenic
1052332744 9:27286720-27286742 AATAATAATCTCTTCAGACATGG - Intronic
1053597825 9:39581460-39581482 ACTAAAACTTTGTTCATACAAGG - Intergenic
1053855846 9:42338464-42338486 ACTAAAACTTTGTTCATACAAGG - Intergenic
1054709261 9:68494729-68494751 TCTCAAGATGTCTTAAGACAAGG - Intronic
1054990940 9:71326075-71326097 AGTAAAAATATTTTCTGACATGG - Intronic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056833915 9:89939244-89939266 ACAACAAATGACTTCAGAAAGGG - Intergenic
1059142017 9:111862312-111862334 TTTAAAAATATTTTCAGACAGGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061223434 9:129266032-129266054 ACAAAAAATTTTTTGAGACAGGG + Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186220471 X:7344381-7344403 ACAAAATGTGTCTTCCGACACGG + Intronic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186748288 X:12593422-12593444 AATAAAAATGTCTTTACACCTGG - Intronic
1187177131 X:16906015-16906037 ATTAAAACTTTTTTCAGACAGGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187464938 X:19518762-19518784 ACAAAAAATGTCTTAGAACAAGG - Intergenic
1187927771 X:24265539-24265561 AATCTAAATGTCTTCAGAAAGGG - Intergenic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188284402 X:28310617-28310639 ACTGAAAATGTTATCAGAAAGGG - Intergenic
1188660759 X:32755294-32755316 AAAAATATTGTCTTCAGACAAGG + Intronic
1188777372 X:34237107-34237129 ACTATAAATAACTTTAGACAAGG + Intergenic
1188964473 X:36534760-36534782 ACTGTAAGTGTCTTAAGACAAGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189796222 X:44648216-44648238 AATAAAACTGTCTACAGAAAGGG - Intergenic
1192408861 X:70914590-70914612 AAGAAAAATGTTTTCAGAAAAGG + Intergenic
1193314241 X:80045469-80045491 GCTGAAAATGTCTTCACAGATGG + Intergenic
1193587171 X:83339296-83339318 ACTAAAGATGCCAACAGACATGG - Intergenic
1193632082 X:83901858-83901880 ACTCAAACTCTCTTGAGACAGGG + Intergenic
1194191920 X:90848167-90848189 ACTAAACATGTCTACAACCAAGG - Intergenic
1194269236 X:91789510-91789532 ACTAAGAAAGGCTGCAGACAAGG - Intronic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196014690 X:110925341-110925363 AGTAAATTTGTCTTCAGAAATGG + Intergenic
1196844325 X:119886637-119886659 AGTAAAACTGGCTTAAGACAAGG - Intergenic
1197024718 X:121735040-121735062 AGTAAAAATATCTTTAGTCATGG - Intergenic
1197149229 X:123202380-123202402 ACTAAAAATGCCTTCCAACAAGG + Intronic
1198313715 X:135445529-135445551 ACTAAAAACGTCTCCAGATCTGG - Intergenic
1198329036 X:135604491-135604513 ACTACAAATGTCCTTTGACATGG - Intergenic
1198337509 X:135681089-135681111 ACTACAAATGTCCTTTGACATGG + Intergenic
1198361676 X:135901722-135901744 ACTACAAATGTCCTTTGACATGG - Intronic
1198930243 X:141849793-141849815 AATGAAAATTTCTTCAGCCACGG + Intronic
1198990114 X:142503686-142503708 AATAAAAAAGACTTTAGACAAGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1200538558 Y:4430602-4430624 ACTAAACATGTCTACAACCAAGG - Intergenic
1200586454 Y:5010499-5010521 ACTAAGAAAGGCTGCAGACAAGG - Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic