ID: 1088359731

View in Genome Browser
Species Human (GRCh38)
Location 11:108977826-108977848
Sequence GAGCCACTGGCTATTCACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088359731_1088359739 14 Left 1088359731 11:108977826-108977848 CCCGTGTGAATAGCCAGTGGCTC No data
Right 1088359739 11:108977863-108977885 AGTGGCTGCAGAGAATCTCCAGG No data
1088359731_1088359735 -4 Left 1088359731 11:108977826-108977848 CCCGTGTGAATAGCCAGTGGCTC No data
Right 1088359735 11:108977845-108977867 GCTCCTGCTGGCATCCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088359731 Original CRISPR GAGCCACTGGCTATTCACAC GGG (reversed) Intergenic
No off target data available for this crispr