ID: 1088366320

View in Genome Browser
Species Human (GRCh38)
Location 11:109043893-109043915
Sequence CAGGAAAGGCAGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088366312_1088366320 -4 Left 1088366312 11:109043874-109043896 CCCAGAACAAGGTTAGCCACAGG No data
Right 1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG No data
1088366314_1088366320 -5 Left 1088366314 11:109043875-109043897 CCAGAACAAGGTTAGCCACAGGA No data
Right 1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088366320 Original CRISPR CAGGAAAGGCAGGAGGTGGA AGG Intergenic
No off target data available for this crispr