ID: 1088366715

View in Genome Browser
Species Human (GRCh38)
Location 11:109047557-109047579
Sequence AGTTAGGTACACAACTTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088366715_1088366718 24 Left 1088366715 11:109047557-109047579 CCGCCAAAGTTGTGTACCTAACT No data
Right 1088366718 11:109047604-109047626 ACACAATCACCTTTCTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088366715 Original CRISPR AGTTAGGTACACAACTTTGG CGG (reversed) Intergenic
No off target data available for this crispr