ID: 1088367094

View in Genome Browser
Species Human (GRCh38)
Location 11:109051188-109051210
Sequence GGTCCAAGTGCAGAACGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088367094_1088367102 29 Left 1088367094 11:109051188-109051210 CCTGCACGTTCTGCACTTGGACC No data
Right 1088367102 11:109051240-109051262 TAAGGCTGGTTCTGGGAGTGTGG No data
1088367094_1088367100 21 Left 1088367094 11:109051188-109051210 CCTGCACGTTCTGCACTTGGACC No data
Right 1088367100 11:109051232-109051254 TATATATATAAGGCTGGTTCTGG No data
1088367094_1088367101 22 Left 1088367094 11:109051188-109051210 CCTGCACGTTCTGCACTTGGACC No data
Right 1088367101 11:109051233-109051255 ATATATATAAGGCTGGTTCTGGG No data
1088367094_1088367103 30 Left 1088367094 11:109051188-109051210 CCTGCACGTTCTGCACTTGGACC No data
Right 1088367103 11:109051241-109051263 AAGGCTGGTTCTGGGAGTGTGGG No data
1088367094_1088367098 11 Left 1088367094 11:109051188-109051210 CCTGCACGTTCTGCACTTGGACC No data
Right 1088367098 11:109051222-109051244 ATTATATTTGTATATATATAAGG No data
1088367094_1088367099 15 Left 1088367094 11:109051188-109051210 CCTGCACGTTCTGCACTTGGACC No data
Right 1088367099 11:109051226-109051248 TATTTGTATATATATAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088367094 Original CRISPR GGTCCAAGTGCAGAACGTGC AGG (reversed) Intergenic
No off target data available for this crispr