ID: 1088368450

View in Genome Browser
Species Human (GRCh38)
Location 11:109063274-109063296
Sequence GACTCAGCTGTTCCTCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088368445_1088368450 30 Left 1088368445 11:109063221-109063243 CCAGGACTCTTTTTTTCTAATCC No data
Right 1088368450 11:109063274-109063296 GACTCAGCTGTTCCTCATTCAGG No data
1088368449_1088368450 9 Left 1088368449 11:109063242-109063264 CCTGGTGGTTAATACTGTTGGAT No data
Right 1088368450 11:109063274-109063296 GACTCAGCTGTTCCTCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088368450 Original CRISPR GACTCAGCTGTTCCTCATTC AGG Intergenic
No off target data available for this crispr