ID: 1088368791

View in Genome Browser
Species Human (GRCh38)
Location 11:109066449-109066471
Sequence GTTTGAGGAGAGTTGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088368783_1088368791 22 Left 1088368783 11:109066404-109066426 CCTGATCTGGAAGTTCAAAGGCC No data
Right 1088368791 11:109066449-109066471 GTTTGAGGAGAGTTGGCAGCTGG No data
1088368788_1088368791 1 Left 1088368788 11:109066425-109066447 CCTTTTAACAGGAGGAGTAGGGT No data
Right 1088368791 11:109066449-109066471 GTTTGAGGAGAGTTGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088368791 Original CRISPR GTTTGAGGAGAGTTGGCAGC TGG Intergenic
No off target data available for this crispr