ID: 1088371252

View in Genome Browser
Species Human (GRCh38)
Location 11:109090674-109090696
Sequence AGTCACCCCCTAGAATTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088371252_1088371256 15 Left 1088371252 11:109090674-109090696 CCTCTAAATTCTAGGGGGTGACT No data
Right 1088371256 11:109090712-109090734 ATAGAAGCTCCATCTTCATCTGG No data
1088371252_1088371257 16 Left 1088371252 11:109090674-109090696 CCTCTAAATTCTAGGGGGTGACT No data
Right 1088371257 11:109090713-109090735 TAGAAGCTCCATCTTCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088371252 Original CRISPR AGTCACCCCCTAGAATTTAG AGG (reversed) Intergenic
No off target data available for this crispr