ID: 1088375233

View in Genome Browser
Species Human (GRCh38)
Location 11:109133552-109133574
Sequence TGAGCACTGCTTCCTCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088375233_1088375236 -9 Left 1088375233 11:109133552-109133574 CCCTCTGGAGGAAGCAGTGCTCA No data
Right 1088375236 11:109133566-109133588 CAGTGCTCAAGGTGCCATCTTGG No data
1088375233_1088375238 5 Left 1088375233 11:109133552-109133574 CCCTCTGGAGGAAGCAGTGCTCA No data
Right 1088375238 11:109133580-109133602 CCATCTTGGAAGCAGAGACCAGG 0: 28
1: 95
2: 144
3: 181
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088375233 Original CRISPR TGAGCACTGCTTCCTCCAGA GGG (reversed) Intergenic
No off target data available for this crispr