ID: 1088379155

View in Genome Browser
Species Human (GRCh38)
Location 11:109173916-109173938
Sequence ACACTATCCCAGCCAACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088379155_1088379156 30 Left 1088379155 11:109173916-109173938 CCTGGTGTTGGCTGGGATAGTGT No data
Right 1088379156 11:109173969-109173991 ACTTAGAATCTTTTTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088379155 Original CRISPR ACACTATCCCAGCCAACACC AGG (reversed) Intergenic
No off target data available for this crispr