ID: 1088382172

View in Genome Browser
Species Human (GRCh38)
Location 11:109205657-109205679
Sequence CCATGCACTTACTGTGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088382170_1088382172 5 Left 1088382170 11:109205629-109205651 CCATTTTAAGCTTAACTTTGAAA No data
Right 1088382172 11:109205657-109205679 CCATGCACTTACTGTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088382172 Original CRISPR CCATGCACTTACTGTGAACC AGG Intergenic
No off target data available for this crispr