ID: 1088385079

View in Genome Browser
Species Human (GRCh38)
Location 11:109245325-109245347
Sequence TCTAATATCCAGAGTCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11925
Summary {0: 5, 1: 262, 2: 1831, 3: 5135, 4: 4692}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088385077_1088385079 24 Left 1088385077 11:109245278-109245300 CCTACAAAATGAGAGAAAAATTT No data
Right 1088385079 11:109245325-109245347 TCTAATATCCAGAGTCTAGAAGG 0: 5
1: 262
2: 1831
3: 5135
4: 4692
1088385078_1088385079 -9 Left 1088385078 11:109245311-109245333 CCATCTGACAAAGATCTAATATC 0: 78
1: 1377
2: 5676
3: 3197
4: 1597
Right 1088385079 11:109245325-109245347 TCTAATATCCAGAGTCTAGAAGG 0: 5
1: 262
2: 1831
3: 5135
4: 4692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088385079 Original CRISPR TCTAATATCCAGAGTCTAGA AGG Intergenic
Too many off-targets to display for this crispr