ID: 1088385079 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:109245325-109245347 |
| Sequence | TCTAATATCCAGAGTCTAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 11925 | |||
| Summary | {0: 5, 1: 262, 2: 1831, 3: 5135, 4: 4692} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1088385077_1088385079 | 24 | Left | 1088385077 | 11:109245278-109245300 | CCTACAAAATGAGAGAAAAATTT | No data | ||
| Right | 1088385079 | 11:109245325-109245347 | TCTAATATCCAGAGTCTAGAAGG | 0: 5 1: 262 2: 1831 3: 5135 4: 4692 |
||||
| 1088385078_1088385079 | -9 | Left | 1088385078 | 11:109245311-109245333 | CCATCTGACAAAGATCTAATATC | 0: 78 1: 1377 2: 5676 3: 3197 4: 1597 |
||
| Right | 1088385079 | 11:109245325-109245347 | TCTAATATCCAGAGTCTAGAAGG | 0: 5 1: 262 2: 1831 3: 5135 4: 4692 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1088385079 | Original CRISPR | TCTAATATCCAGAGTCTAGA AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||