ID: 1088391993

View in Genome Browser
Species Human (GRCh38)
Location 11:109324601-109324623
Sequence CAGTGTGGTCTCAGTCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088391993_1088391998 -5 Left 1088391993 11:109324601-109324623 CCCTCTAGACTGAGACCACACTG No data
Right 1088391998 11:109324619-109324641 CACTGTACCAGAAAGTGGATGGG No data
1088391993_1088392001 2 Left 1088391993 11:109324601-109324623 CCCTCTAGACTGAGACCACACTG No data
Right 1088392001 11:109324626-109324648 CCAGAAAGTGGATGGGACATGGG No data
1088391993_1088391999 1 Left 1088391993 11:109324601-109324623 CCCTCTAGACTGAGACCACACTG No data
Right 1088391999 11:109324625-109324647 ACCAGAAAGTGGATGGGACATGG No data
1088391993_1088391997 -6 Left 1088391993 11:109324601-109324623 CCCTCTAGACTGAGACCACACTG No data
Right 1088391997 11:109324618-109324640 ACACTGTACCAGAAAGTGGATGG No data
1088391993_1088391995 -10 Left 1088391993 11:109324601-109324623 CCCTCTAGACTGAGACCACACTG No data
Right 1088391995 11:109324614-109324636 GACCACACTGTACCAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088391993 Original CRISPR CAGTGTGGTCTCAGTCTAGA GGG (reversed) Intergenic
No off target data available for this crispr