ID: 1088392692

View in Genome Browser
Species Human (GRCh38)
Location 11:109332604-109332626
Sequence TTCATGAAGTCCCAAGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088392691_1088392692 25 Left 1088392691 11:109332556-109332578 CCTGATCTATTTAAGTCTCTTTT No data
Right 1088392692 11:109332604-109332626 TTCATGAAGTCCCAAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088392692 Original CRISPR TTCATGAAGTCCCAAGTTCC AGG Intergenic
No off target data available for this crispr