ID: 1088393262

View in Genome Browser
Species Human (GRCh38)
Location 11:109339483-109339505
Sequence CCTCACATAATGAAGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088393262_1088393264 -9 Left 1088393262 11:109339483-109339505 CCATCTTTCTTCATTATGTGAGG No data
Right 1088393264 11:109339497-109339519 TATGTGAGGACACAGTGCGAAGG No data
1088393262_1088393265 17 Left 1088393262 11:109339483-109339505 CCATCTTTCTTCATTATGTGAGG No data
Right 1088393265 11:109339523-109339545 TCATCTGCCAGCCGAAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088393262 Original CRISPR CCTCACATAATGAAGAAAGA TGG (reversed) Intergenic
No off target data available for this crispr